FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632732_at:

>probe:Drosophila_2:1632732_at:42:189; Interrogation_Position=1657; Antisense; AACACCAATAGTCCACAGCCGGCAG
>probe:Drosophila_2:1632732_at:494:395; Interrogation_Position=1694; Antisense; GAAATCTAATCGCATCGCTGGAGTG
>probe:Drosophila_2:1632732_at:48:55; Interrogation_Position=1724; Antisense; ATGCAAGTCGCAAGGTCTGTGTGAA
>probe:Drosophila_2:1632732_at:341:109; Interrogation_Position=1754; Antisense; AGAAGCTGCTCAAGTCGCCGCAGAG
>probe:Drosophila_2:1632732_at:654:297; Interrogation_Position=1786; Antisense; CGCGTGCTGGAATACTCGGTGCGTC
>probe:Drosophila_2:1632732_at:687:549; Interrogation_Position=1847; Antisense; GGAATCCCCAGAAAATTCGTCCCAT
>probe:Drosophila_2:1632732_at:646:25; Interrogation_Position=1870; Antisense; ATACCAAAAATCCATGTGCGTCCGC
>probe:Drosophila_2:1632732_at:172:339; Interrogation_Position=1952; Antisense; GCTAGACTCTAATCACATCCAATGG
>probe:Drosophila_2:1632732_at:334:19; Interrogation_Position=1982; Antisense; ATTTCGGCAACTGATCTGTGTTCTA
>probe:Drosophila_2:1632732_at:319:513; Interrogation_Position=1999; Antisense; GTGTTCTATATCTATTACCTGTACT
>probe:Drosophila_2:1632732_at:140:601; Interrogation_Position=2018; Antisense; TGTACTGAAGTATTTGGCTCGCAAT
>probe:Drosophila_2:1632732_at:351:337; Interrogation_Position=2034; Antisense; GCTCGCAATTGCAGACTCATCGTAT
>probe:Drosophila_2:1632732_at:729:513; Interrogation_Position=2082; Antisense; GTGTTAGGGCTTTTCCTAGCGCAAA
>probe:Drosophila_2:1632732_at:170:149; Interrogation_Position=2141; Antisense; ACTATTTTGCACTACCTGTGACGGC

Paste this into a BLAST search page for me
AACACCAATAGTCCACAGCCGGCAGGAAATCTAATCGCATCGCTGGAGTGATGCAAGTCGCAAGGTCTGTGTGAAAGAAGCTGCTCAAGTCGCCGCAGAGCGCGTGCTGGAATACTCGGTGCGTCGGAATCCCCAGAAAATTCGTCCCATATACCAAAAATCCATGTGCGTCCGCGCTAGACTCTAATCACATCCAATGGATTTCGGCAACTGATCTGTGTTCTAGTGTTCTATATCTATTACCTGTACTTGTACTGAAGTATTTGGCTCGCAATGCTCGCAATTGCAGACTCATCGTATGTGTTAGGGCTTTTCCTAGCGCAAAACTATTTTGCACTACCTGTGACGGC

Full Affymetrix probeset data:

Annotations for 1632732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720