FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632736_at:

>probe:Drosophila_2:1632736_at:134:593; Interrogation_Position=436; Antisense; TGGTGAACCAGCTGCATCCTGAGCT
>probe:Drosophila_2:1632736_at:273:353; Interrogation_Position=466; Antisense; GCAGCGATCGCTATCTGTTCTTCCA
>probe:Drosophila_2:1632736_at:417:647; Interrogation_Position=508; Antisense; TCATCGAGCTGATACGCGCCGGCAA
>probe:Drosophila_2:1632736_at:296:173; Interrogation_Position=559; Antisense; AAAGCAAGCTGTCCGAGTCCGGCGA
>probe:Drosophila_2:1632736_at:267:59; Interrogation_Position=591; Antisense; ATGTTTGAGCTGGAGCGCACCCTGG
>probe:Drosophila_2:1632736_at:551:715; Interrogation_Position=627; Antisense; TTCGAGAAGCCGCAGGAGAGCCCCT
>probe:Drosophila_2:1632736_at:72:553; Interrogation_Position=665; Antisense; GGAGCAGTCGTACCGCCAGAAGATC
>probe:Drosophila_2:1632736_at:169:215; Interrogation_Position=684; Antisense; AAGATCGCTAGCGAGCTCAACTCGG
>probe:Drosophila_2:1632736_at:316:135; Interrogation_Position=741; Antisense; ACGCCCAAAATGATGTTCCTGCTCA
>probe:Drosophila_2:1632736_at:288:207; Interrogation_Position=765; Antisense; AAGCTGATCTTGTGGGCCCAGTCCA
>probe:Drosophila_2:1632736_at:417:299; Interrogation_Position=801; Antisense; CGCTCCATTAGCTATCCCAAGATGA
>probe:Drosophila_2:1632736_at:60:377; Interrogation_Position=824; Antisense; GAAGAACCTAGAGACGGCGCACCTG
>probe:Drosophila_2:1632736_at:437:403; Interrogation_Position=882; Antisense; GACTTCTTTTGCTAATGCTATTGCT
>probe:Drosophila_2:1632736_at:187:659; Interrogation_Position=972; Antisense; TAAGTAGCCGGAAACTCCATCACTC

Paste this into a BLAST search page for me
TGGTGAACCAGCTGCATCCTGAGCTGCAGCGATCGCTATCTGTTCTTCCATCATCGAGCTGATACGCGCCGGCAAAAAGCAAGCTGTCCGAGTCCGGCGAATGTTTGAGCTGGAGCGCACCCTGGTTCGAGAAGCCGCAGGAGAGCCCCTGGAGCAGTCGTACCGCCAGAAGATCAAGATCGCTAGCGAGCTCAACTCGGACGCCCAAAATGATGTTCCTGCTCAAAGCTGATCTTGTGGGCCCAGTCCACGCTCCATTAGCTATCCCAAGATGAGAAGAACCTAGAGACGGCGCACCTGGACTTCTTTTGCTAATGCTATTGCTTAAGTAGCCGGAAACTCCATCACTC

Full Affymetrix probeset data:

Annotations for 1632736_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720