FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632739_at:

>probe:Drosophila_2:1632739_at:256:153; Interrogation_Position=332; Antisense; ACATCGAGCAGTACCGCCAGCGAAT
>probe:Drosophila_2:1632739_at:420:381; Interrogation_Position=391; Antisense; GAACCGGACTTCTTCAGTGAGCTGA
>probe:Drosophila_2:1632739_at:353:33; Interrogation_Position=424; Antisense; ATCAAGCCGCAGATGAAGTTCTACC
>probe:Drosophila_2:1632739_at:626:215; Interrogation_Position=439; Antisense; AAGTTCTACCTGGAGGATCCATCCA
>probe:Drosophila_2:1632739_at:272:437; Interrogation_Position=451; Antisense; GAGGATCCATCCACGAGTGCGGCGA
>probe:Drosophila_2:1632739_at:258:575; Interrogation_Position=471; Antisense; GGCGACCAGCCAACAAAGTGACTTT
>probe:Drosophila_2:1632739_at:306:611; Interrogation_Position=489; Antisense; TGACTTTTCAAGACTGCAGGCCCAG
>probe:Drosophila_2:1632739_at:195:267; Interrogation_Position=505; Antisense; CAGGCCCAGGACTTGGTGCCAATTA
>probe:Drosophila_2:1632739_at:596:503; Interrogation_Position=520; Antisense; GTGCCAATTAGCGTAAATGCCGATC
>probe:Drosophila_2:1632739_at:266:663; Interrogation_Position=533; Antisense; TAAATGCCGATCTCGAGGACTGGGT
>probe:Drosophila_2:1632739_at:467:103; Interrogation_Position=599; Antisense; AGACCAAGCACATTCTGCGTGAGAA
>probe:Drosophila_2:1632739_at:338:109; Interrogation_Position=620; Antisense; AGAAGCGTCGTGAGTTGCGCCATCA
>probe:Drosophila_2:1632739_at:581:119; Interrogation_Position=711; Antisense; AGCGGCGTAGTTGTAGCTGCACCAG
>probe:Drosophila_2:1632739_at:567:395; Interrogation_Position=849; Antisense; GAAATAAATCTTGCCTTTCACTCGC

Paste this into a BLAST search page for me
ACATCGAGCAGTACCGCCAGCGAATGAACCGGACTTCTTCAGTGAGCTGAATCAAGCCGCAGATGAAGTTCTACCAAGTTCTACCTGGAGGATCCATCCAGAGGATCCATCCACGAGTGCGGCGAGGCGACCAGCCAACAAAGTGACTTTTGACTTTTCAAGACTGCAGGCCCAGCAGGCCCAGGACTTGGTGCCAATTAGTGCCAATTAGCGTAAATGCCGATCTAAATGCCGATCTCGAGGACTGGGTAGACCAAGCACATTCTGCGTGAGAAAGAAGCGTCGTGAGTTGCGCCATCAAGCGGCGTAGTTGTAGCTGCACCAGGAAATAAATCTTGCCTTTCACTCGC

Full Affymetrix probeset data:

Annotations for 1632739_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720