FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632740_at:

>probe:Drosophila_2:1632740_at:656:373; Interrogation_Position=119; Antisense; GAAGTAACTGTGACCGATGCCAAAA
>probe:Drosophila_2:1632740_at:337:365; Interrogation_Position=196; Antisense; GAATACCTGTCGCTGTTGCAAATGT
>probe:Drosophila_2:1632740_at:281:295; Interrogation_Position=259; Antisense; CGAGGACGCGGAATGCATCTGCAAT
>probe:Drosophila_2:1632740_at:200:257; Interrogation_Position=292; Antisense; CAAATGCACCTGTGTGGCCGGGAAT
>probe:Drosophila_2:1632740_at:468:225; Interrogation_Position=314; Antisense; AATGAGTTTCCCACGGAGTTTGGCT
>probe:Drosophila_2:1632740_at:283:433; Interrogation_Position=341; Antisense; GAGTGCGATCTCACCAACTTGGAGC
>probe:Drosophila_2:1632740_at:51:553; Interrogation_Position=361; Antisense; GGAGCAAACTCTTCGCGAGCTTATA
>probe:Drosophila_2:1632740_at:104:201; Interrogation_Position=389; Antisense; AACGCCGAGTGCATATGCTACTTGA
>probe:Drosophila_2:1632740_at:592:83; Interrogation_Position=444; Antisense; AGTGGGCACCCAAAGTCTACTACGA
>probe:Drosophila_2:1632740_at:642:623; Interrogation_Position=484; Antisense; TCCGTTTGTCCTAAATCCTAAGCCA
>probe:Drosophila_2:1632740_at:322:505; Interrogation_Position=531; Antisense; GTCCATTTTGCAACCCGTGCTATAA
>probe:Drosophila_2:1632740_at:165:475; Interrogation_Position=588; Antisense; GTTACACCTGCGACTACAACTGTGA
>probe:Drosophila_2:1632740_at:64:597; Interrogation_Position=617; Antisense; TGTGGTCGCTTTTGAAATTCTCCCC
>probe:Drosophila_2:1632740_at:312:651; Interrogation_Position=680; Antisense; TCAACATTTACTTAGCGGACGCCAA

Paste this into a BLAST search page for me
GAAGTAACTGTGACCGATGCCAAAAGAATACCTGTCGCTGTTGCAAATGTCGAGGACGCGGAATGCATCTGCAATCAAATGCACCTGTGTGGCCGGGAATAATGAGTTTCCCACGGAGTTTGGCTGAGTGCGATCTCACCAACTTGGAGCGGAGCAAACTCTTCGCGAGCTTATAAACGCCGAGTGCATATGCTACTTGAAGTGGGCACCCAAAGTCTACTACGATCCGTTTGTCCTAAATCCTAAGCCAGTCCATTTTGCAACCCGTGCTATAAGTTACACCTGCGACTACAACTGTGATGTGGTCGCTTTTGAAATTCTCCCCTCAACATTTACTTAGCGGACGCCAA

Full Affymetrix probeset data:

Annotations for 1632740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720