FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632742_at:

>probe:Drosophila_2:1632742_at:185:121; Interrogation_Position=2067; Antisense; AGCGTAGTGCCTTCAGGAGTCTGGT
>probe:Drosophila_2:1632742_at:146:73; Interrogation_Position=2129; Antisense; AGGCAATATGCCGTGGCTGCATCAT
>probe:Drosophila_2:1632742_at:279:335; Interrogation_Position=2144; Antisense; GCTGCATCATTAACGGTCGCCGAGG
>probe:Drosophila_2:1632742_at:415:75; Interrogation_Position=2166; Antisense; AGGAGCAGCGCTCCAGATTGCACTA
>probe:Drosophila_2:1632742_at:84:95; Interrogation_Position=2180; Antisense; AGATTGCACTACTCCGCAGGTGGTT
>probe:Drosophila_2:1632742_at:173:491; Interrogation_Position=2217; Antisense; GTGAGGGCACGGGACCCAATACCAA
>probe:Drosophila_2:1632742_at:707:235; Interrogation_Position=2250; Antisense; AATCTGGCGGCTCAACCATGACGGT
>probe:Drosophila_2:1632742_at:231:559; Interrogation_Position=2275; Antisense; GGACAACTCGTCATCGGACTCGGAT
>probe:Drosophila_2:1632742_at:40:453; Interrogation_Position=2305; Antisense; GATCAACGTGCACGACGATTCCGAT
>probe:Drosophila_2:1632742_at:633:579; Interrogation_Position=2395; Antisense; GGCCACGTTGCAATTCCTAAAGCAT
>probe:Drosophila_2:1632742_at:55:159; Interrogation_Position=2445; Antisense; ACAAGGGCCACCTGGTCTAGATGGG
>probe:Drosophila_2:1632742_at:641:387; Interrogation_Position=2488; Antisense; GAAAACCTGAGTTGTGCGCGCCTCT
>probe:Drosophila_2:1632742_at:356:323; Interrogation_Position=2505; Antisense; GCGCCTCTGTGATTGACAGTGGCAA
>probe:Drosophila_2:1632742_at:402:205; Interrogation_Position=2616; Antisense; AAGCGACTACACACACAGTGGGCAA

Paste this into a BLAST search page for me
AGCGTAGTGCCTTCAGGAGTCTGGTAGGCAATATGCCGTGGCTGCATCATGCTGCATCATTAACGGTCGCCGAGGAGGAGCAGCGCTCCAGATTGCACTAAGATTGCACTACTCCGCAGGTGGTTGTGAGGGCACGGGACCCAATACCAAAATCTGGCGGCTCAACCATGACGGTGGACAACTCGTCATCGGACTCGGATGATCAACGTGCACGACGATTCCGATGGCCACGTTGCAATTCCTAAAGCATACAAGGGCCACCTGGTCTAGATGGGGAAAACCTGAGTTGTGCGCGCCTCTGCGCCTCTGTGATTGACAGTGGCAAAAGCGACTACACACACAGTGGGCAA

Full Affymetrix probeset data:

Annotations for 1632742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720