Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632745_at:

>probe:Drosophila_2:1632745_at:332:653; Interrogation_Position=1126; Antisense; TCAAGCACGATCTGGAGTCCCGAGA
>probe:Drosophila_2:1632745_at:340:455; Interrogation_Position=1149; Antisense; GATCAAGTCATCACCAGTCTGCTAA
>probe:Drosophila_2:1632745_at:463:385; Interrogation_Position=1254; Antisense; GAACAGCTCCTCAGCCAGCGGGAAG
>probe:Drosophila_2:1632745_at:48:77; Interrogation_Position=1309; Antisense; AGGATGCCCTGGTCATGCCCAAGGA
>probe:Drosophila_2:1632745_at:396:223; Interrogation_Position=1329; Antisense; AAGGATCCCATGTGCTTCGGCGAAC
>probe:Drosophila_2:1632745_at:351:685; Interrogation_Position=1359; Antisense; TATCGAATGCAAGTGGCCCAGCGGG
>probe:Drosophila_2:1632745_at:367:383; Interrogation_Position=1385; Antisense; GAACACCCGGCGCTTGGATGTCCAA
>probe:Drosophila_2:1632745_at:328:153; Interrogation_Position=1420; Antisense; ACATGGCCCACATGGTCGTGGAGGC
>probe:Drosophila_2:1632745_at:613:239; Interrogation_Position=1449; Antisense; AATAACAGGAAAGCCGCTGCCCAGG
>probe:Drosophila_2:1632745_at:470:537; Interrogation_Position=1496; Antisense; GGTCTACAACCAACAGAATCGCCAG
>probe:Drosophila_2:1632745_at:312:253; Interrogation_Position=1559; Antisense; CAAGCAGCCACCTGAAGTTCTTTCA
>probe:Drosophila_2:1632745_at:47:393; Interrogation_Position=1592; Antisense; GAAATCCATTCTCACCGAAGAGGAG
>probe:Drosophila_2:1632745_at:634:429; Interrogation_Position=1649; Antisense; GAGTTTTCATTTAATACGCGCTAGA
>probe:Drosophila_2:1632745_at:587:671; Interrogation_Position=1663; Antisense; TACGCGCTAGATGCCCGTATTAAGG

Paste this into a BLAST search page for me
TCAAGCACGATCTGGAGTCCCGAGAGATCAAGTCATCACCAGTCTGCTAAGAACAGCTCCTCAGCCAGCGGGAAGAGGATGCCCTGGTCATGCCCAAGGAAAGGATCCCATGTGCTTCGGCGAACTATCGAATGCAAGTGGCCCAGCGGGGAACACCCGGCGCTTGGATGTCCAAACATGGCCCACATGGTCGTGGAGGCAATAACAGGAAAGCCGCTGCCCAGGGGTCTACAACCAACAGAATCGCCAGCAAGCAGCCACCTGAAGTTCTTTCAGAAATCCATTCTCACCGAAGAGGAGGAGTTTTCATTTAATACGCGCTAGATACGCGCTAGATGCCCGTATTAAGG

Full Affymetrix probeset data:

Annotations for 1632745_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime