FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632746_at:

>probe:Drosophila_2:1632746_at:324:263; Interrogation_Position=312; Antisense; CAGCAGTCCTGCGAAGAGTCCCAAG
>probe:Drosophila_2:1632746_at:523:461; Interrogation_Position=360; Antisense; GATTCAGAACACCAGCCGGTACGAT
>probe:Drosophila_2:1632746_at:224:427; Interrogation_Position=428; Antisense; GAGATCGCCAGGTGCCGGATTATTG
>probe:Drosophila_2:1632746_at:294:95; Interrogation_Position=497; Antisense; AGAGTCGCGCCATTAGTCCCGGGTA
>probe:Drosophila_2:1632746_at:322:507; Interrogation_Position=571; Antisense; GTGCGATCTAAATCCCGTCCAGAAA
>probe:Drosophila_2:1632746_at:387:243; Interrogation_Position=594; Antisense; AATTTCAAGTGCAGCGGCATCGCGA
>probe:Drosophila_2:1632746_at:217:233; Interrogation_Position=625; Antisense; AATCTCTCCTATTGGAAGGCACGCC
>probe:Drosophila_2:1632746_at:531:225; Interrogation_Position=640; Antisense; AAGGCACGCCGTGTGGTGTTCTACC
>probe:Drosophila_2:1632746_at:633:287; Interrogation_Position=711; Antisense; CGGACGGGATGTAACCTCACTGGAC
>probe:Drosophila_2:1632746_at:599:37; Interrogation_Position=737; Antisense; ATCTTCTCGATAAGATCTCGCCCAA
>probe:Drosophila_2:1632746_at:624:507; Interrogation_Position=779; Antisense; GTGCTCGATATGTGTTCTCCATGGA
>probe:Drosophila_2:1632746_at:129:77; Interrogation_Position=836; Antisense; AGGATGGAGCCTTCTATGTCGTATC
>probe:Drosophila_2:1632746_at:700:59; Interrogation_Position=851; Antisense; ATGTCGTATCCTCGTTCAAGGCCTT
>probe:Drosophila_2:1632746_at:269:579; Interrogation_Position=870; Antisense; GGCCTTCAAGTTAGTGTGCCGGTTG

Paste this into a BLAST search page for me
CAGCAGTCCTGCGAAGAGTCCCAAGGATTCAGAACACCAGCCGGTACGATGAGATCGCCAGGTGCCGGATTATTGAGAGTCGCGCCATTAGTCCCGGGTAGTGCGATCTAAATCCCGTCCAGAAAAATTTCAAGTGCAGCGGCATCGCGAAATCTCTCCTATTGGAAGGCACGCCAAGGCACGCCGTGTGGTGTTCTACCCGGACGGGATGTAACCTCACTGGACATCTTCTCGATAAGATCTCGCCCAAGTGCTCGATATGTGTTCTCCATGGAAGGATGGAGCCTTCTATGTCGTATCATGTCGTATCCTCGTTCAAGGCCTTGGCCTTCAAGTTAGTGTGCCGGTTG

Full Affymetrix probeset data:

Annotations for 1632746_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720