FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632747_at:

>probe:Drosophila_2:1632747_at:178:615; Interrogation_Position=1008; Antisense; TGAAGGAGCGCTCGCTGACCGCCAA
>probe:Drosophila_2:1632747_at:271:525; Interrogation_Position=1060; Antisense; GGGCACTAAAAGCATCGCATCGTTT
>probe:Drosophila_2:1632747_at:442:173; Interrogation_Position=1068; Antisense; AAAGCATCGCATCGTTTTTCAAAGC
>probe:Drosophila_2:1632747_at:107:77; Interrogation_Position=633; Antisense; AGGAGAAGCAAGTCCACTGCGGCCA
>probe:Drosophila_2:1632747_at:240:313; Interrogation_Position=654; Antisense; GCCACAGTGCGCAGTCGCAGAATTT
>probe:Drosophila_2:1632747_at:35:395; Interrogation_Position=719; Antisense; GAAATGGACTACACGCGCATGGCTT
>probe:Drosophila_2:1632747_at:706:297; Interrogation_Position=734; Antisense; CGCATGGCTTGCGATTATGTGGGAC
>probe:Drosophila_2:1632747_at:107:689; Interrogation_Position=761; Antisense; TATTTGGATGCGGATCTGCACGGCT
>probe:Drosophila_2:1632747_at:164:707; Interrogation_Position=796; Antisense; TTACCTGCACATTCCTAGCGAGATT
>probe:Drosophila_2:1632747_at:34:117; Interrogation_Position=844; Antisense; AGCTTCTCAGAAGCGCAAGTCGGTG
>probe:Drosophila_2:1632747_at:219:83; Interrogation_Position=882; Antisense; AGGGCAGCGACTCCAAGAAGATCAA
>probe:Drosophila_2:1632747_at:526:425; Interrogation_Position=914; Antisense; GAGAGCGATGCTGCTGCCAAGCTAA
>probe:Drosophila_2:1632747_at:674:309; Interrogation_Position=929; Antisense; GCCAAGCTAAAGTCCAGCGGTCTAG
>probe:Drosophila_2:1632747_at:578:399; Interrogation_Position=956; Antisense; GACAGCGATGGCGATCCCAATGCCA

Paste this into a BLAST search page for me
TGAAGGAGCGCTCGCTGACCGCCAAGGGCACTAAAAGCATCGCATCGTTTAAAGCATCGCATCGTTTTTCAAAGCAGGAGAAGCAAGTCCACTGCGGCCAGCCACAGTGCGCAGTCGCAGAATTTGAAATGGACTACACGCGCATGGCTTCGCATGGCTTGCGATTATGTGGGACTATTTGGATGCGGATCTGCACGGCTTTACCTGCACATTCCTAGCGAGATTAGCTTCTCAGAAGCGCAAGTCGGTGAGGGCAGCGACTCCAAGAAGATCAAGAGAGCGATGCTGCTGCCAAGCTAAGCCAAGCTAAAGTCCAGCGGTCTAGGACAGCGATGGCGATCCCAATGCCA

Full Affymetrix probeset data:

Annotations for 1632747_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720