FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632748_at:

>probe:Drosophila_2:1632748_at:543:461; Interrogation_Position=1003; Antisense; GATTACTCCTCCTCAGACAATGATT
>probe:Drosophila_2:1632748_at:717:395; Interrogation_Position=1018; Antisense; GACAATGATTCCAACGGCTGATTTT
>probe:Drosophila_2:1632748_at:376:67; Interrogation_Position=571; Antisense; AGGCCCGTGCTCCAGAAACTAGTGG
>probe:Drosophila_2:1632748_at:501:687; Interrogation_Position=625; Antisense; TATATGGCCAATAGTCGCCTACGCG
>probe:Drosophila_2:1632748_at:179:673; Interrogation_Position=644; Antisense; TACGCGCCGAGTTTCGCCAGCAGAA
>probe:Drosophila_2:1632748_at:50:637; Interrogation_Position=699; Antisense; TCGACAGTTGTTGGCCAAGAGCAGC
>probe:Drosophila_2:1632748_at:119:715; Interrogation_Position=740; Antisense; TTCCGGAGACCACACAAGATCGCGA
>probe:Drosophila_2:1632748_at:145:67; Interrogation_Position=766; Antisense; ATGGCAGCCCTGATGAAGTTGCAGA
>probe:Drosophila_2:1632748_at:514:89; Interrogation_Position=794; Antisense; AGTCAGCTCTGGAACGGGAATCCGA
>probe:Drosophila_2:1632748_at:303:289; Interrogation_Position=855; Antisense; CGGAGCAACAGTCACCACATTTGGT
>probe:Drosophila_2:1632748_at:289:257; Interrogation_Position=870; Antisense; CACATTTGGTGGACTCAAGCGACAA
>probe:Drosophila_2:1632748_at:721:169; Interrogation_Position=894; Antisense; AAAGGTTCTGAATACCCAGCTCCAA
>probe:Drosophila_2:1632748_at:148:489; Interrogation_Position=919; Antisense; GTACAGGATCTTGGCATACGGCGTA
>probe:Drosophila_2:1632748_at:151:107; Interrogation_Position=954; Antisense; AGAAACTACATCTTCAGCCACGAAC

Paste this into a BLAST search page for me
GATTACTCCTCCTCAGACAATGATTGACAATGATTCCAACGGCTGATTTTAGGCCCGTGCTCCAGAAACTAGTGGTATATGGCCAATAGTCGCCTACGCGTACGCGCCGAGTTTCGCCAGCAGAATCGACAGTTGTTGGCCAAGAGCAGCTTCCGGAGACCACACAAGATCGCGAATGGCAGCCCTGATGAAGTTGCAGAAGTCAGCTCTGGAACGGGAATCCGACGGAGCAACAGTCACCACATTTGGTCACATTTGGTGGACTCAAGCGACAAAAAGGTTCTGAATACCCAGCTCCAAGTACAGGATCTTGGCATACGGCGTAAGAAACTACATCTTCAGCCACGAAC

Full Affymetrix probeset data:

Annotations for 1632748_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720