FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632749_at:

>probe:Drosophila_2:1632749_at:724:501; Interrogation_Position=104; Antisense; GTCGAGTGTACTGTGAGAATATCTA
>probe:Drosophila_2:1632749_at:123:465; Interrogation_Position=133; Antisense; GATTGTCAACGATTTACATCCAGAA
>probe:Drosophila_2:1632749_at:345:7; Interrogation_Position=182; Antisense; ATTCCTTTAATCGTCATTGTCGTCG
>probe:Drosophila_2:1632749_at:596:635; Interrogation_Position=192; Antisense; TCGTCATTGTCGTCGGGAGCGCAGA
>probe:Drosophila_2:1632749_at:236:521; Interrogation_Position=222; Antisense; GTGGAACAGTGTGTCTCGATGTGAA
>probe:Drosophila_2:1632749_at:492:583; Interrogation_Position=248; Antisense; TGGAAAAAGCCACCTGTCTTCTGAT
>probe:Drosophila_2:1632749_at:652:497; Interrogation_Position=263; Antisense; GTCTTCTGATTTTTCGACGCTGTGA
>probe:Drosophila_2:1632749_at:399:135; Interrogation_Position=279; Antisense; ACGCTGTGATGATATGTCCTGTAAC
>probe:Drosophila_2:1632749_at:209:597; Interrogation_Position=293; Antisense; TGTCCTGTAACAACATTGCAGATGT
>probe:Drosophila_2:1632749_at:292:343; Interrogation_Position=385; Antisense; GCTTAAGCAATAACAGTCTGGCAAT
>probe:Drosophila_2:1632749_at:550:21; Interrogation_Position=46; Antisense; ATATTCTTGCTGTTGGTTCTTTGTA
>probe:Drosophila_2:1632749_at:348:471; Interrogation_Position=61; Antisense; GTTCTTTGTATCCTGCAATTGTGCC
>probe:Drosophila_2:1632749_at:393:249; Interrogation_Position=76; Antisense; CAATTGTGCCACATTGATGCTCAAT
>probe:Drosophila_2:1632749_at:595:445; Interrogation_Position=91; Antisense; GATGCTCAATGGAGTCGAGTGTACT

Paste this into a BLAST search page for me
GTCGAGTGTACTGTGAGAATATCTAGATTGTCAACGATTTACATCCAGAAATTCCTTTAATCGTCATTGTCGTCGTCGTCATTGTCGTCGGGAGCGCAGAGTGGAACAGTGTGTCTCGATGTGAATGGAAAAAGCCACCTGTCTTCTGATGTCTTCTGATTTTTCGACGCTGTGAACGCTGTGATGATATGTCCTGTAACTGTCCTGTAACAACATTGCAGATGTGCTTAAGCAATAACAGTCTGGCAATATATTCTTGCTGTTGGTTCTTTGTAGTTCTTTGTATCCTGCAATTGTGCCCAATTGTGCCACATTGATGCTCAATGATGCTCAATGGAGTCGAGTGTACT

Full Affymetrix probeset data:

Annotations for 1632749_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720