FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632751_at:

>probe:Drosophila_2:1632751_at:617:49; Interrogation_Position=1016; Antisense; ATGCCTTCATCCACTACTGTCAGAT
>probe:Drosophila_2:1632751_at:695:27; Interrogation_Position=1039; Antisense; ATACCTGCCTCTTTTGCGGAATGTG
>probe:Drosophila_2:1632751_at:31:231; Interrogation_Position=1058; Antisense; AATGTGTGGAGACCGCTGTTCTGAC
>probe:Drosophila_2:1632751_at:495:467; Interrogation_Position=1075; Antisense; GTTCTGACGGACGTTGACTTTCCAC
>probe:Drosophila_2:1632751_at:188:403; Interrogation_Position=1090; Antisense; GACTTTCCACAATGCTGTTGGACTT
>probe:Drosophila_2:1632751_at:384:621; Interrogation_Position=1170; Antisense; TGCTGCCGACGGAGCTGCTGACGCA
>probe:Drosophila_2:1632751_at:700:541; Interrogation_Position=1294; Antisense; GGTTCCAAGAGGAGCACTACCACAT
>probe:Drosophila_2:1632751_at:414:445; Interrogation_Position=1321; Antisense; GATGAATCCGAATTTCCCGAGGGAA
>probe:Drosophila_2:1632751_at:333:561; Interrogation_Position=1366; Antisense; GGAACACCGATCTCCAAGTTTGGCG
>probe:Drosophila_2:1632751_at:127:211; Interrogation_Position=805; Antisense; AAGCAACTGGTGAGTGCCCACGACG
>probe:Drosophila_2:1632751_at:206:433; Interrogation_Position=816; Antisense; GAGTGCCCACGACGACTATGAGAAG
>probe:Drosophila_2:1632751_at:595:179; Interrogation_Position=886; Antisense; AAACAGAGGGCTGGACCACCTGTAC
>probe:Drosophila_2:1632751_at:409:383; Interrogation_Position=915; Antisense; GAACGGATGCAAATCGCCCAAGGGT
>probe:Drosophila_2:1632751_at:303:403; Interrogation_Position=978; Antisense; GACTTGTGGAGCTCTTACTTGTCAA

Paste this into a BLAST search page for me
ATGCCTTCATCCACTACTGTCAGATATACCTGCCTCTTTTGCGGAATGTGAATGTGTGGAGACCGCTGTTCTGACGTTCTGACGGACGTTGACTTTCCACGACTTTCCACAATGCTGTTGGACTTTGCTGCCGACGGAGCTGCTGACGCAGGTTCCAAGAGGAGCACTACCACATGATGAATCCGAATTTCCCGAGGGAAGGAACACCGATCTCCAAGTTTGGCGAAGCAACTGGTGAGTGCCCACGACGGAGTGCCCACGACGACTATGAGAAGAAACAGAGGGCTGGACCACCTGTACGAACGGATGCAAATCGCCCAAGGGTGACTTGTGGAGCTCTTACTTGTCAA

Full Affymetrix probeset data:

Annotations for 1632751_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720