FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632752_at:

>probe:Drosophila_2:1632752_at:683:187; Interrogation_Position=1011; Antisense; AACGGCACCCTCTAAATTATATACT
>probe:Drosophila_2:1632752_at:351:391; Interrogation_Position=1086; Antisense; GAAACTGGCGTGTGCAATTATCAAG
>probe:Drosophila_2:1632752_at:100:527; Interrogation_Position=1240; Antisense; GGGCAATCTCTCTCAGAAAGAGCGA
>probe:Drosophila_2:1632752_at:634:259; Interrogation_Position=1265; Antisense; CACGAGTGGCATTCGTTGTGGTCGT
>probe:Drosophila_2:1632752_at:248:193; Interrogation_Position=1316; Antisense; AACTACTGCATACTAATATCGGTGT
>probe:Drosophila_2:1632752_at:37:613; Interrogation_Position=1405; Antisense; TGAATACATGCATACCTACCCGAAT
>probe:Drosophila_2:1632752_at:561:25; Interrogation_Position=1434; Antisense; ATAGGCGCAGCAAGTCTGCGTTAGC
>probe:Drosophila_2:1632752_at:457:187; Interrogation_Position=861; Antisense; AACTTAAGTCACACATTCGGGAGGC
>probe:Drosophila_2:1632752_at:284:273; Interrogation_Position=874; Antisense; CATTCGGGAGGCAATCTAAATCTAA
>probe:Drosophila_2:1632752_at:264:191; Interrogation_Position=892; Antisense; AATCTAAATGTCTGCGAATCCAAAC
>probe:Drosophila_2:1632752_at:586:45; Interrogation_Position=909; Antisense; ATCCAAACGAATTCTTTGCACGCCC
>probe:Drosophila_2:1632752_at:219:301; Interrogation_Position=931; Antisense; CCCCTCGTCCCACAAATATTTATTG
>probe:Drosophila_2:1632752_at:122:701; Interrogation_Position=949; Antisense; TTTATTGTATGAATCGCTAGAGCCA
>probe:Drosophila_2:1632752_at:48:159; Interrogation_Position=997; Antisense; AAATCGATGCGTTTAACGGCACCCT

Paste this into a BLAST search page for me
AACGGCACCCTCTAAATTATATACTGAAACTGGCGTGTGCAATTATCAAGGGGCAATCTCTCTCAGAAAGAGCGACACGAGTGGCATTCGTTGTGGTCGTAACTACTGCATACTAATATCGGTGTTGAATACATGCATACCTACCCGAATATAGGCGCAGCAAGTCTGCGTTAGCAACTTAAGTCACACATTCGGGAGGCCATTCGGGAGGCAATCTAAATCTAAAATCTAAATGTCTGCGAATCCAAACATCCAAACGAATTCTTTGCACGCCCCCCCTCGTCCCACAAATATTTATTGTTTATTGTATGAATCGCTAGAGCCAAAATCGATGCGTTTAACGGCACCCT

Full Affymetrix probeset data:

Annotations for 1632752_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720