FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632754_at:

>probe:Drosophila_2:1632754_at:645:191; Interrogation_Position=170; Antisense; AACTCCTGCAGGACTATGACTGGGT
>probe:Drosophila_2:1632754_at:462:613; Interrogation_Position=210; Antisense; TGAACGCAGATGTGCCGGAGATCTT
>probe:Drosophila_2:1632754_at:246:187; Interrogation_Position=272; Antisense; AACACGGATGCACTGGTACCGATCT
>probe:Drosophila_2:1632754_at:604:641; Interrogation_Position=294; Antisense; TCTCAACCGGAACTTCAGACATGGA
>probe:Drosophila_2:1632754_at:64:171; Interrogation_Position=325; Antisense; AAAGGAGACGCCTCGAGTAATCCAG
>probe:Drosophila_2:1632754_at:702:107; Interrogation_Position=362; Antisense; AGAAGAGTTCTCCTCGATTTGGCAA
>probe:Drosophila_2:1632754_at:563:459; Interrogation_Position=377; Antisense; GATTTGGCAAGCTCCGCACGTGGCA
>probe:Drosophila_2:1632754_at:138:355; Interrogation_Position=392; Antisense; GCACGTGGCATATTATACCTTTCGA
>probe:Drosophila_2:1632754_at:81:689; Interrogation_Position=411; Antisense; TTTCGATTCATTCCGCTTTAGGCGA
>probe:Drosophila_2:1632754_at:391:373; Interrogation_Position=463; Antisense; GAAGTGGTCCAAGCAGTCATAGATG
>probe:Drosophila_2:1632754_at:609:185; Interrogation_Position=527; Antisense; AACAAGGTCCCTTATATGCTTATGA
>probe:Drosophila_2:1632754_at:511:259; Interrogation_Position=569; Antisense; CACTCGCTATGGAGCTTCCGGATAA
>probe:Drosophila_2:1632754_at:174:163; Interrogation_Position=606; Antisense; AAATTTCGAGTTCCATCCATCAACG
>probe:Drosophila_2:1632754_at:502:539; Interrogation_Position=667; Antisense; GGTATACGCGCCATTGCATGCAAAT

Paste this into a BLAST search page for me
AACTCCTGCAGGACTATGACTGGGTTGAACGCAGATGTGCCGGAGATCTTAACACGGATGCACTGGTACCGATCTTCTCAACCGGAACTTCAGACATGGAAAAGGAGACGCCTCGAGTAATCCAGAGAAGAGTTCTCCTCGATTTGGCAAGATTTGGCAAGCTCCGCACGTGGCAGCACGTGGCATATTATACCTTTCGATTTCGATTCATTCCGCTTTAGGCGAGAAGTGGTCCAAGCAGTCATAGATGAACAAGGTCCCTTATATGCTTATGACACTCGCTATGGAGCTTCCGGATAAAAATTTCGAGTTCCATCCATCAACGGGTATACGCGCCATTGCATGCAAAT

Full Affymetrix probeset data:

Annotations for 1632754_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720