FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632755_at:

>probe:Drosophila_2:1632755_at:313:165; Interrogation_Position=306; Antisense; AAATCTGCTGGTTGTGACTGGAACT
>probe:Drosophila_2:1632755_at:188:517; Interrogation_Position=339; Antisense; GTGGGATCTGTATGCTCCGTACTAC
>probe:Drosophila_2:1632755_at:212:609; Interrogation_Position=368; Antisense; TGAGCCAGATCCATGTGCACTGCAA
>probe:Drosophila_2:1632755_at:673:159; Interrogation_Position=398; Antisense; ACAAGCCGCTGTATCACAATGACAT
>probe:Drosophila_2:1632755_at:106:31; Interrogation_Position=475; Antisense; ATAACCTTGGCGGATATCGATGAAT
>probe:Drosophila_2:1632755_at:12:363; Interrogation_Position=511; Antisense; GATAAGTTGACCTTTGCCGGTTGGG
>probe:Drosophila_2:1632755_at:266:65; Interrogation_Position=550; Antisense; ATGGGCACCTATGGTCGCTATCTGC
>probe:Drosophila_2:1632755_at:596:617; Interrogation_Position=572; Antisense; TGCAGGAGGCATCCGGCACATATCT
>probe:Drosophila_2:1632755_at:15:413; Interrogation_Position=643; Antisense; GACCTGGGTCATGTGTGTGTCCAAA
>probe:Drosophila_2:1632755_at:74:575; Interrogation_Position=703; Antisense; GGCGGACCGCTTATCGATGAGCAGC
>probe:Drosophila_2:1632755_at:350:113; Interrogation_Position=725; Antisense; AGCAGCGCTTGGTAGGCATCGGTAA
>probe:Drosophila_2:1632755_at:297:567; Interrogation_Position=772; Antisense; GGCTATCCGGTAAGTATTCCGCCTA
>probe:Drosophila_2:1632755_at:483:679; Interrogation_Position=843; Antisense; TAGGATGTGTATGCGCGTACTGCCT
>probe:Drosophila_2:1632755_at:41:489; Interrogation_Position=859; Antisense; GTACTGCCTTCTACCACGATTGGAT

Paste this into a BLAST search page for me
AAATCTGCTGGTTGTGACTGGAACTGTGGGATCTGTATGCTCCGTACTACTGAGCCAGATCCATGTGCACTGCAAACAAGCCGCTGTATCACAATGACATATAACCTTGGCGGATATCGATGAATGATAAGTTGACCTTTGCCGGTTGGGATGGGCACCTATGGTCGCTATCTGCTGCAGGAGGCATCCGGCACATATCTGACCTGGGTCATGTGTGTGTCCAAAGGCGGACCGCTTATCGATGAGCAGCAGCAGCGCTTGGTAGGCATCGGTAAGGCTATCCGGTAAGTATTCCGCCTATAGGATGTGTATGCGCGTACTGCCTGTACTGCCTTCTACCACGATTGGAT

Full Affymetrix probeset data:

Annotations for 1632755_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720