Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632756_at:

>probe:Drosophila_2:1632756_at:300:551; Interrogation_Position=3683; Antisense; GGAGCAGCATCGGTCCAACTGGGAC
>probe:Drosophila_2:1632756_at:588:527; Interrogation_Position=3703; Antisense; GGGACAACTACTTGCGGCTGAGCCA
>probe:Drosophila_2:1632756_at:442:411; Interrogation_Position=3722; Antisense; GAGCCAGTACTTTGGACGTTACCGG
>probe:Drosophila_2:1632756_at:555:615; Interrogation_Position=3784; Antisense; TGCAATCTCTGCTCGGCTTCATGGA
>probe:Drosophila_2:1632756_at:355:119; Interrogation_Position=3814; Antisense; AGCTGCGTGCCAATGTGTCCAAAAA
>probe:Drosophila_2:1632756_at:631:663; Interrogation_Position=3841; Antisense; TAAAGATTCTGCATCTGGCCGAGGA
>probe:Drosophila_2:1632756_at:677:691; Interrogation_Position=3875; Antisense; TTTGATGGACGGTCTGCGATTCACC
>probe:Drosophila_2:1632756_at:245:463; Interrogation_Position=3892; Antisense; GATTCACCTCGTGCAAGAGCGCCAA
>probe:Drosophila_2:1632756_at:536:223; Interrogation_Position=3915; Antisense; AAGGATCGCACTGGCATGGCGGTCA
>probe:Drosophila_2:1632756_at:234:321; Interrogation_Position=3965; Antisense; GCGCGAGTTTCAGCTGCCGGCAAAG
>probe:Drosophila_2:1632756_at:693:397; Interrogation_Position=4038; Antisense; GACAACGTGCTCAAGAACATCGGGA
>probe:Drosophila_2:1632756_at:342:275; Interrogation_Position=4076; Antisense; CTTCAATCGAACTCAGGTCTCTTTT
>probe:Drosophila_2:1632756_at:569:539; Interrogation_Position=4128; Antisense; GGTAGTTACGGCAAGGCGCAGACTT
>probe:Drosophila_2:1632756_at:43:23; Interrogation_Position=4169; Antisense; ATATCCGTTGCCGAGTGTTCCATTG

Paste this into a BLAST search page for me
GGAGCAGCATCGGTCCAACTGGGACGGGACAACTACTTGCGGCTGAGCCAGAGCCAGTACTTTGGACGTTACCGGTGCAATCTCTGCTCGGCTTCATGGAAGCTGCGTGCCAATGTGTCCAAAAATAAAGATTCTGCATCTGGCCGAGGATTTGATGGACGGTCTGCGATTCACCGATTCACCTCGTGCAAGAGCGCCAAAAGGATCGCACTGGCATGGCGGTCAGCGCGAGTTTCAGCTGCCGGCAAAGGACAACGTGCTCAAGAACATCGGGACTTCAATCGAACTCAGGTCTCTTTTGGTAGTTACGGCAAGGCGCAGACTTATATCCGTTGCCGAGTGTTCCATTG

Full Affymetrix probeset data:

Annotations for 1632756_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime