FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632758_at:

>probe:Drosophila_2:1632758_at:182:331; Interrogation_Position=1431; Antisense; GCGGCTGCACCTGCGAGTTAAAGCA
>probe:Drosophila_2:1632758_at:174:475; Interrogation_Position=1447; Antisense; GTTAAAGCAGCATGCCTATCCGCAC
>probe:Drosophila_2:1632758_at:460:645; Interrogation_Position=1473; Antisense; TCTTCACCTACTTGACACCATTTAG
>probe:Drosophila_2:1632758_at:434:559; Interrogation_Position=1516; Antisense; GGACAAGACCCATCCAAAGGAGGAA
>probe:Drosophila_2:1632758_at:709:607; Interrogation_Position=1570; Antisense; TGAGGATCTGCTGTCAAAGCCACCG
>probe:Drosophila_2:1632758_at:330:47; Interrogation_Position=1606; Antisense; ATCCTTAAACACCTATCGCTGCTGG
>probe:Drosophila_2:1632758_at:202:43; Interrogation_Position=1642; Antisense; ATCGAGCAGCCATTCTAGTGATGAG
>probe:Drosophila_2:1632758_at:668:511; Interrogation_Position=1659; Antisense; GTGATGAGGCTAAGCCACCACTCGT
>probe:Drosophila_2:1632758_at:681:309; Interrogation_Position=1676; Antisense; CCACTCGTGGTGGTTATGGGCGAAA
>probe:Drosophila_2:1632758_at:716:97; Interrogation_Position=1707; Antisense; AGAGCAATTTTCAGGTTACGGTCAA
>probe:Drosophila_2:1632758_at:287:707; Interrogation_Position=1722; Antisense; TTACGGTCAAGGAACAACATCACTC
>probe:Drosophila_2:1632758_at:96:629; Interrogation_Position=1840; Antisense; TCCACCTGTCTCTCAAAAAGCGGAG
>probe:Drosophila_2:1632758_at:291:459; Interrogation_Position=1886; Antisense; GATATCTTGGACATCATAGGCTTAA
>probe:Drosophila_2:1632758_at:70:173; Interrogation_Position=1996; Antisense; AAAGAGTTCGTGTGCTGTGTCAATG

Paste this into a BLAST search page for me
GCGGCTGCACCTGCGAGTTAAAGCAGTTAAAGCAGCATGCCTATCCGCACTCTTCACCTACTTGACACCATTTAGGGACAAGACCCATCCAAAGGAGGAATGAGGATCTGCTGTCAAAGCCACCGATCCTTAAACACCTATCGCTGCTGGATCGAGCAGCCATTCTAGTGATGAGGTGATGAGGCTAAGCCACCACTCGTCCACTCGTGGTGGTTATGGGCGAAAAGAGCAATTTTCAGGTTACGGTCAATTACGGTCAAGGAACAACATCACTCTCCACCTGTCTCTCAAAAAGCGGAGGATATCTTGGACATCATAGGCTTAAAAAGAGTTCGTGTGCTGTGTCAATG

Full Affymetrix probeset data:

Annotations for 1632758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720