FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632759_at:

>probe:Drosophila_2:1632759_at:176:669; Interrogation_Position=1005; Antisense; TACGAATACGCTGGGAGAAGTTGAC
>probe:Drosophila_2:1632759_at:332:301; Interrogation_Position=1038; Antisense; CGCCACAATCTTCCCGATGATTAAT
>probe:Drosophila_2:1632759_at:705:603; Interrogation_Position=1055; Antisense; TGATTAATATTACCGTTACGCCCAA
>probe:Drosophila_2:1632759_at:412:357; Interrogation_Position=1110; Antisense; GCACAATTCCGGAGCTATGAATTTA
>probe:Drosophila_2:1632759_at:424:615; Interrogation_Position=1127; Antisense; TGAATTTAAAATCCCTGCACTCAGC
>probe:Drosophila_2:1632759_at:332:285; Interrogation_Position=1141; Antisense; CTGCACTCAGCATGTCCAGTGATAA
>probe:Drosophila_2:1632759_at:548:329; Interrogation_Position=1166; Antisense; GCGGTTCCAAATACGGTGAGCTTTA
>probe:Drosophila_2:1632759_at:196:467; Interrogation_Position=612; Antisense; GTTGTCGACCAAGCAGAACTGCGCT
>probe:Drosophila_2:1632759_at:58:383; Interrogation_Position=627; Antisense; GAACTGCGCTGTTGTGGTCCAAAAA
>probe:Drosophila_2:1632759_at:185:129; Interrogation_Position=682; Antisense; ACCACGACGCCATTCACGCGGATTG
>probe:Drosophila_2:1632759_at:95:141; Interrogation_Position=797; Antisense; ACTCGAGTAATTTCGGATTATCCCT
>probe:Drosophila_2:1632759_at:576:461; Interrogation_Position=812; Antisense; GATTATCCCTTACTGATTCAGGCCA
>probe:Drosophila_2:1632759_at:388:79; Interrogation_Position=966; Antisense; AGGTGGGCACTACATGTTGCACTAC
>probe:Drosophila_2:1632759_at:332:469; Interrogation_Position=981; Antisense; GTTGCACTACGACTTTCATGAATAT

Paste this into a BLAST search page for me
TACGAATACGCTGGGAGAAGTTGACCGCCACAATCTTCCCGATGATTAATTGATTAATATTACCGTTACGCCCAAGCACAATTCCGGAGCTATGAATTTATGAATTTAAAATCCCTGCACTCAGCCTGCACTCAGCATGTCCAGTGATAAGCGGTTCCAAATACGGTGAGCTTTAGTTGTCGACCAAGCAGAACTGCGCTGAACTGCGCTGTTGTGGTCCAAAAAACCACGACGCCATTCACGCGGATTGACTCGAGTAATTTCGGATTATCCCTGATTATCCCTTACTGATTCAGGCCAAGGTGGGCACTACATGTTGCACTACGTTGCACTACGACTTTCATGAATAT

Full Affymetrix probeset data:

Annotations for 1632759_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720