Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632762_s_at:

>probe:Drosophila_2:1632762_s_at:502:313; Interrogation_Position=129; Antisense; GCCAGAATACCCTGAATCCATTGGG
>probe:Drosophila_2:1632762_s_at:458:35; Interrogation_Position=212; Antisense; ATCATTCTGCGCAACCATTCCATCG
>probe:Drosophila_2:1632762_s_at:125:359; Interrogation_Position=222; Antisense; GCAACCATTCCATCGACTTGTCGAA
>probe:Drosophila_2:1632762_s_at:33:403; Interrogation_Position=236; Antisense; GACTTGTCGAATCCGCCCCTGAAAT
>probe:Drosophila_2:1632762_s_at:475:393; Interrogation_Position=25; Antisense; GAAATTTTAAGGGTTCTGATTGCAC
>probe:Drosophila_2:1632762_s_at:433:657; Interrogation_Position=32; Antisense; TAAGGGTTCTGATTGCACTTCTCGC
>probe:Drosophila_2:1632762_s_at:73:327; Interrogation_Position=348; Antisense; GCGAGTGCGCCAAGTTTATTTGCCG
>probe:Drosophila_2:1632762_s_at:238:323; Interrogation_Position=354; Antisense; GCGCCAAGTTTATTTGCCGCAACTG
>probe:Drosophila_2:1632762_s_at:34:309; Interrogation_Position=357; Antisense; CCAAGTTTATTTGCCGCAACTGCGT
>probe:Drosophila_2:1632762_s_at:107:605; Interrogation_Position=41; Antisense; TGATTGCACTTCTCGCTGACCTCAA
>probe:Drosophila_2:1632762_s_at:554:311; Interrogation_Position=435; Antisense; GCCAGATGTTCCTCAGCTAGGGCAT
>probe:Drosophila_2:1632762_s_at:619:59; Interrogation_Position=440; Antisense; ATGTTCCTCAGCTAGGGCATCAAAC
>probe:Drosophila_2:1632762_s_at:525:679; Interrogation_Position=452; Antisense; TAGGGCATCAAACAATCAAGCAAAT
>probe:Drosophila_2:1632762_s_at:618:715; Interrogation_Position=50; Antisense; TTCTCGCTGACCTCAAACAAATCAA

Paste this into a BLAST search page for me
GCCAGAATACCCTGAATCCATTGGGATCATTCTGCGCAACCATTCCATCGGCAACCATTCCATCGACTTGTCGAAGACTTGTCGAATCCGCCCCTGAAATGAAATTTTAAGGGTTCTGATTGCACTAAGGGTTCTGATTGCACTTCTCGCGCGAGTGCGCCAAGTTTATTTGCCGGCGCCAAGTTTATTTGCCGCAACTGCCAAGTTTATTTGCCGCAACTGCGTTGATTGCACTTCTCGCTGACCTCAAGCCAGATGTTCCTCAGCTAGGGCATATGTTCCTCAGCTAGGGCATCAAACTAGGGCATCAAACAATCAAGCAAATTTCTCGCTGACCTCAAACAAATCAA

Full Affymetrix probeset data:

Annotations for 1632762_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime