FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632764_at:

>probe:Drosophila_2:1632764_at:545:667; Interrogation_Position=1492; Antisense; TACATCATCAGGTTCTGCGCCGTGG
>probe:Drosophila_2:1632764_at:710:175; Interrogation_Position=1521; Antisense; AAACGCGACCGCTGAGGACATTGAC
>probe:Drosophila_2:1632764_at:161:557; Interrogation_Position=1536; Antisense; GGACATTGACTACGCCTGGGACATC
>probe:Drosophila_2:1632764_at:12:529; Interrogation_Position=1553; Antisense; GGGACATCATCGTGGACTTTGCCAA
>probe:Drosophila_2:1632764_at:559:417; Interrogation_Position=1606; Antisense; GAGCTGTCCGAGATCATGAACCGCA
>probe:Drosophila_2:1632764_at:326:109; Interrogation_Position=1631; Antisense; AGAAGCAGGACACGCTGGCCCAGAA
>probe:Drosophila_2:1632764_at:273:109; Interrogation_Position=1652; Antisense; AGAAGCGCTCATTCTTCGTGCGCAT
>probe:Drosophila_2:1632764_at:243:447; Interrogation_Position=1684; Antisense; GATCCGAAGATCTACAACCCGGCGA
>probe:Drosophila_2:1632764_at:340:275; Interrogation_Position=1781; Antisense; TTATCCGGACCCAGAGTTCGGTGGA
>probe:Drosophila_2:1632764_at:456:1; Interrogation_Position=1796; Antisense; GTTCGGTGGACCACAACTCGTGGAT
>probe:Drosophila_2:1632764_at:49:193; Interrogation_Position=1810; Antisense; AACTCGTGGATATCCTGGCCGCTGG
>probe:Drosophila_2:1632764_at:194:571; Interrogation_Position=1833; Antisense; GGCATTCCTCTTCAACAGCAACAAC
>probe:Drosophila_2:1632764_at:65:221; Interrogation_Position=1864; Antisense; AAGGGCAGTAACGTCTCGTTGCGTT
>probe:Drosophila_2:1632764_at:124:643; Interrogation_Position=1951; Antisense; TCACCCTCTCCGGAAAACGAGTTGG

Paste this into a BLAST search page for me
TACATCATCAGGTTCTGCGCCGTGGAAACGCGACCGCTGAGGACATTGACGGACATTGACTACGCCTGGGACATCGGGACATCATCGTGGACTTTGCCAAGAGCTGTCCGAGATCATGAACCGCAAGAAGCAGGACACGCTGGCCCAGAAAGAAGCGCTCATTCTTCGTGCGCATGATCCGAAGATCTACAACCCGGCGATTATCCGGACCCAGAGTTCGGTGGAGTTCGGTGGACCACAACTCGTGGATAACTCGTGGATATCCTGGCCGCTGGGGCATTCCTCTTCAACAGCAACAACAAGGGCAGTAACGTCTCGTTGCGTTTCACCCTCTCCGGAAAACGAGTTGG

Full Affymetrix probeset data:

Annotations for 1632764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720