FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632765_at:

>probe:Drosophila_2:1632765_at:720:33; Interrogation_Position=3074; Antisense; ATCAAATACGCATCACTGTCGCAGC
>probe:Drosophila_2:1632765_at:245:281; Interrogation_Position=3121; Antisense; CTGCGCTTTTGATCTGGTGGACTAC
>probe:Drosophila_2:1632765_at:720:531; Interrogation_Position=3136; Antisense; GGTGGACTACACAACGCTCTTTAAG
>probe:Drosophila_2:1632765_at:453:585; Interrogation_Position=3174; Antisense; TGGAACCCAATGAACTGTGCCGTCT
>probe:Drosophila_2:1632765_at:664:421; Interrogation_Position=3242; Antisense; GAGAATCCCTACACGGATCTCATGT
>probe:Drosophila_2:1632765_at:50:139; Interrogation_Position=3267; Antisense; ACGAGGTGCTCAACGATCAGAATCT
>probe:Drosophila_2:1632765_at:666:35; Interrogation_Position=3282; Antisense; ATCAGAATCTGTGGGCCGTTTGCGG
>probe:Drosophila_2:1632765_at:472:339; Interrogation_Position=3309; Antisense; GCTCAGCGGGTGTCGTATCCATGAA
>probe:Drosophila_2:1632765_at:178:557; Interrogation_Position=3334; Antisense; GGACGTCGACAGTCATTCCATATCG
>probe:Drosophila_2:1632765_at:78:23; Interrogation_Position=3353; Antisense; ATATCGCTGGATGTAATGCCGCTGA
>probe:Drosophila_2:1632765_at:198:51; Interrogation_Position=3395; Antisense; ATGCCCAGCATTCGATTATCCAAGT
>probe:Drosophila_2:1632765_at:574:89; Interrogation_Position=3437; Antisense; AGTAAAACCGATGGCCACTCCAAGG
>probe:Drosophila_2:1632765_at:17:539; Interrogation_Position=3479; Antisense; GGTCAAGTCTACAACTCCACGAAGA
>probe:Drosophila_2:1632765_at:120:351; Interrogation_Position=3508; Antisense; GCAGATCCATGTCATCGCAAGTGTG

Paste this into a BLAST search page for me
ATCAAATACGCATCACTGTCGCAGCCTGCGCTTTTGATCTGGTGGACTACGGTGGACTACACAACGCTCTTTAAGTGGAACCCAATGAACTGTGCCGTCTGAGAATCCCTACACGGATCTCATGTACGAGGTGCTCAACGATCAGAATCTATCAGAATCTGTGGGCCGTTTGCGGGCTCAGCGGGTGTCGTATCCATGAAGGACGTCGACAGTCATTCCATATCGATATCGCTGGATGTAATGCCGCTGAATGCCCAGCATTCGATTATCCAAGTAGTAAAACCGATGGCCACTCCAAGGGGTCAAGTCTACAACTCCACGAAGAGCAGATCCATGTCATCGCAAGTGTG

Full Affymetrix probeset data:

Annotations for 1632765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720