FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632767_at:

>probe:Drosophila_2:1632767_at:565:179; Interrogation_Position=1030; Antisense; AAACAGGATCTTCAGTTCACCGCCT
>probe:Drosophila_2:1632767_at:622:299; Interrogation_Position=1050; Antisense; CGCCTACGGATTCTTTTCCATAGAC
>probe:Drosophila_2:1632767_at:159:645; Interrogation_Position=1085; Antisense; TCTTCAAGATCTTCTCGGCTGTTAC
>probe:Drosophila_2:1632767_at:364:289; Interrogation_Position=1100; Antisense; CGGCTGTTACTACCTATCTGGTGAT
>probe:Drosophila_2:1632767_at:697:237; Interrogation_Position=631; Antisense; AATCTTCAGGATTGTGGCCACATGG
>probe:Drosophila_2:1632767_at:574:23; Interrogation_Position=682; Antisense; ATAGAGGTCCTTTGCAAATTCCGCT
>probe:Drosophila_2:1632767_at:329:107; Interrogation_Position=716; Antisense; AGAATATTAACTGCGTGGCCGGAGT
>probe:Drosophila_2:1632767_at:189:577; Interrogation_Position=731; Antisense; TGGCCGGAGTTTCATTGCTATTCTA
>probe:Drosophila_2:1632767_at:686:5; Interrogation_Position=744; Antisense; ATTGCTATTCTACTTTGGCTTCTCC
>probe:Drosophila_2:1632767_at:80:237; Interrogation_Position=784; Antisense; AATCAGAGTTACTTGGCCTTTGCCA
>probe:Drosophila_2:1632767_at:69:1; Interrogation_Position=816; Antisense; AGCCGGCTCGTTGAGTTCCAAAACA
>probe:Drosophila_2:1632767_at:262:605; Interrogation_Position=905; Antisense; TGATTTGCAGCGCATGTGACGGCCT
>probe:Drosophila_2:1632767_at:167:611; Interrogation_Position=921; Antisense; TGACGGCCTGGCATCCGAGGTGAAT
>probe:Drosophila_2:1632767_at:301:615; Interrogation_Position=941; Antisense; TGAATGGCACGGCACAGATCCTGGC

Paste this into a BLAST search page for me
AAACAGGATCTTCAGTTCACCGCCTCGCCTACGGATTCTTTTCCATAGACTCTTCAAGATCTTCTCGGCTGTTACCGGCTGTTACTACCTATCTGGTGATAATCTTCAGGATTGTGGCCACATGGATAGAGGTCCTTTGCAAATTCCGCTAGAATATTAACTGCGTGGCCGGAGTTGGCCGGAGTTTCATTGCTATTCTAATTGCTATTCTACTTTGGCTTCTCCAATCAGAGTTACTTGGCCTTTGCCAAGCCGGCTCGTTGAGTTCCAAAACATGATTTGCAGCGCATGTGACGGCCTTGACGGCCTGGCATCCGAGGTGAATTGAATGGCACGGCACAGATCCTGGC

Full Affymetrix probeset data:

Annotations for 1632767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720