Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632771_at:

>probe:Drosophila_2:1632771_at:167:215; Interrogation_Position=1009; Antisense; AAGATCGCAATGACTGAGGGCCACA
>probe:Drosophila_2:1632771_at:455:433; Interrogation_Position=1024; Antisense; GAGGGCCACATGGACTCCTATATGC
>probe:Drosophila_2:1632771_at:376:81; Interrogation_Position=1070; Antisense; AGGGCTTCGAGCATCTAGATCCGTT
>probe:Drosophila_2:1632771_at:249:677; Interrogation_Position=1085; Antisense; TAGATCCGTTTGTGCCCATCCATGT
>probe:Drosophila_2:1632771_at:165:249; Interrogation_Position=1125; Antisense; CAAGGAATTCCACAGCTACATCAGC
>probe:Drosophila_2:1632771_at:231:37; Interrogation_Position=1154; Antisense; ATCTCGACCGACACTGGATCAACAA
>probe:Drosophila_2:1632771_at:218:161; Interrogation_Position=1175; Antisense; ACAAGACGCCGCAGGGATTCGAGGA
>probe:Drosophila_2:1632771_at:672:445; Interrogation_Position=1239; Antisense; GATGCAGCTCGTGAAGGCCTTGTAG
>probe:Drosophila_2:1632771_at:74:327; Interrogation_Position=1267; Antisense; GCGAGTGTCCTGTATTTGTTAGCCA
>probe:Drosophila_2:1632771_at:3:161; Interrogation_Position=1319; Antisense; ACAACGATGCGGTTTGCTTGCTGTA
>probe:Drosophila_2:1632771_at:306:487; Interrogation_Position=1341; Antisense; GTACGCTCACGACTCAATTTGTAAT
>probe:Drosophila_2:1632771_at:8:657; Interrogation_Position=1420; Antisense; TAATGATGCACAGTACTTTCGTACG
>probe:Drosophila_2:1632771_at:392:345; Interrogation_Position=893; Antisense; GCATTTTCTCCGACAACAAGCAGCT
>probe:Drosophila_2:1632771_at:408:209; Interrogation_Position=910; Antisense; AAGCAGCTCGTGACTCCGGATCGGG

Paste this into a BLAST search page for me
AAGATCGCAATGACTGAGGGCCACAGAGGGCCACATGGACTCCTATATGCAGGGCTTCGAGCATCTAGATCCGTTTAGATCCGTTTGTGCCCATCCATGTCAAGGAATTCCACAGCTACATCAGCATCTCGACCGACACTGGATCAACAAACAAGACGCCGCAGGGATTCGAGGAGATGCAGCTCGTGAAGGCCTTGTAGGCGAGTGTCCTGTATTTGTTAGCCAACAACGATGCGGTTTGCTTGCTGTAGTACGCTCACGACTCAATTTGTAATTAATGATGCACAGTACTTTCGTACGGCATTTTCTCCGACAACAAGCAGCTAAGCAGCTCGTGACTCCGGATCGGG

Full Affymetrix probeset data:

Annotations for 1632771_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime