FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632772_at:

>probe:Drosophila_2:1632772_at:300:493; Interrogation_Position=129; Antisense; GTGAGCGGCTACTCGGGACGAATTC
>probe:Drosophila_2:1632772_at:642:555; Interrogation_Position=144; Antisense; GGACGAATTCCACCGGATGCAGATA
>probe:Drosophila_2:1632772_at:427:497; Interrogation_Position=16; Antisense; GTCCAGTTTCGAACACCAAGGCGGT
>probe:Drosophila_2:1632772_at:18:59; Interrogation_Position=183; Antisense; ATGTACCGCGGTGACGTCCTGGAAC
>probe:Drosophila_2:1632772_at:166:139; Interrogation_Position=196; Antisense; ACGTCCTGGAACTGGGTGTCAACAA
>probe:Drosophila_2:1632772_at:548:247; Interrogation_Position=265; Antisense; CAATACTTATCGAGGGTTGCGGCAA
>probe:Drosophila_2:1632772_at:703:181; Interrogation_Position=301; Antisense; AAAACTGCAACCGAGGCGAGCGAAT
>probe:Drosophila_2:1632772_at:689:575; Interrogation_Position=315; Antisense; GGCGAGCGAATCTCTCCGGGTGAAC
>probe:Drosophila_2:1632772_at:427:227; Interrogation_Position=33; Antisense; AAGGCGGTCGCAATGCATCCGGAAC
>probe:Drosophila_2:1632772_at:161:361; Interrogation_Position=373; Antisense; GCAAGCAAATCGGAGCGGCACCCTA
>probe:Drosophila_2:1632772_at:125:355; Interrogation_Position=390; Antisense; GCACCCTACTACATCGAGCGGAATA
>probe:Drosophila_2:1632772_at:209:437; Interrogation_Position=473; Antisense; GAGGACCACCGAAGCCAAGGATGCA
>probe:Drosophila_2:1632772_at:300:279; Interrogation_Position=59; Antisense; CTACGCCAGTCCAAATCCATTGATA
>probe:Drosophila_2:1632772_at:289:27; Interrogation_Position=81; Antisense; ATACCATTGGTAATCGCAGGCGCCC

Paste this into a BLAST search page for me
GTGAGCGGCTACTCGGGACGAATTCGGACGAATTCCACCGGATGCAGATAGTCCAGTTTCGAACACCAAGGCGGTATGTACCGCGGTGACGTCCTGGAACACGTCCTGGAACTGGGTGTCAACAACAATACTTATCGAGGGTTGCGGCAAAAAACTGCAACCGAGGCGAGCGAATGGCGAGCGAATCTCTCCGGGTGAACAAGGCGGTCGCAATGCATCCGGAACGCAAGCAAATCGGAGCGGCACCCTAGCACCCTACTACATCGAGCGGAATAGAGGACCACCGAAGCCAAGGATGCACTACGCCAGTCCAAATCCATTGATAATACCATTGGTAATCGCAGGCGCCC

Full Affymetrix probeset data:

Annotations for 1632772_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720