Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632773_a_at:

>probe:Drosophila_2:1632773_a_at:634:665; Interrogation_Position=715; Antisense; TACAACGAGTACGATAACGAAGATC
>probe:Drosophila_2:1632773_a_at:302:293; Interrogation_Position=726; Antisense; CGATAACGAAGATCTCGAGCTGCAC
>probe:Drosophila_2:1632773_a_at:193:335; Interrogation_Position=744; Antisense; GCTGCACACCATCGAAACCGGCGAT
>probe:Drosophila_2:1632773_a_at:646:155; Interrogation_Position=749; Antisense; ACACCATCGAAACCGGCGATCAGGG
>probe:Drosophila_2:1632773_a_at:139:113; Interrogation_Position=797; Antisense; AGCAAATCGAGATTGCCCATCGGCG
>probe:Drosophila_2:1632773_a_at:193:637; Interrogation_Position=803; Antisense; TCGAGATTGCCCATCGGCGGCAGAA
>probe:Drosophila_2:1632773_a_at:388:331; Interrogation_Position=819; Antisense; GCGGCAGAAGGAGCAACATCAATTG
>probe:Drosophila_2:1632773_a_at:173:371; Interrogation_Position=825; Antisense; GAAGGAGCAACATCAATTGCAGTTG
>probe:Drosophila_2:1632773_a_at:276:265; Interrogation_Position=844; Antisense; CAGTTGCTGGCGCAACGACAACAGC
>probe:Drosophila_2:1632773_a_at:683:351; Interrogation_Position=867; Antisense; GCAGCGACAACTGCTGACAACGACA
>probe:Drosophila_2:1632773_a_at:175:397; Interrogation_Position=872; Antisense; GACAACTGCTGACAACGACAACGGC
>probe:Drosophila_2:1632773_a_at:383:251; Interrogation_Position=914; Antisense; CAATGGCAACAACGTCGAAAGCAAC
>probe:Drosophila_2:1632773_a_at:549:137; Interrogation_Position=925; Antisense; ACGTCGAAAGCAACGGAACCCAATG
>probe:Drosophila_2:1632773_a_at:313:379; Interrogation_Position=940; Antisense; GAACCCAATGATGCCAAATCGGAGG

Paste this into a BLAST search page for me
TACAACGAGTACGATAACGAAGATCCGATAACGAAGATCTCGAGCTGCACGCTGCACACCATCGAAACCGGCGATACACCATCGAAACCGGCGATCAGGGAGCAAATCGAGATTGCCCATCGGCGTCGAGATTGCCCATCGGCGGCAGAAGCGGCAGAAGGAGCAACATCAATTGGAAGGAGCAACATCAATTGCAGTTGCAGTTGCTGGCGCAACGACAACAGCGCAGCGACAACTGCTGACAACGACAGACAACTGCTGACAACGACAACGGCCAATGGCAACAACGTCGAAAGCAACACGTCGAAAGCAACGGAACCCAATGGAACCCAATGATGCCAAATCGGAGG

Full Affymetrix probeset data:

Annotations for 1632773_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime