FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632775_at:

>probe:Drosophila_2:1632775_at:259:277; Interrogation_Position=113; Antisense; CTACAGATAAGATAACCGAGGCCCT
>probe:Drosophila_2:1632775_at:718:199; Interrogation_Position=126; Antisense; AACCGAGGCCCTGATGGATTGGTGC
>probe:Drosophila_2:1632775_at:522:329; Interrogation_Position=165; Antisense; GCGGGACATCGAAACGCACTACGAT
>probe:Drosophila_2:1632775_at:586:331; Interrogation_Position=18; Antisense; GCGGCACAAGTGCTACAGAACCTAT
>probe:Drosophila_2:1632775_at:124:259; Interrogation_Position=181; Antisense; CACTACGATTTCTTCTTGGTCTTTG
>probe:Drosophila_2:1632775_at:709:641; Interrogation_Position=191; Antisense; TCTTCTTGGTCTTTGTCGCCTTGGA
>probe:Drosophila_2:1632775_at:171:503; Interrogation_Position=205; Antisense; GTCGCCTTGGACAGCCAGGAGGATA
>probe:Drosophila_2:1632775_at:585:395; Interrogation_Position=241; Antisense; GAAATTCAAGGCTACCAGGCAATAC
>probe:Drosophila_2:1632775_at:620:97; Interrogation_Position=266; Antisense; AGATGCCTGCATGTGGATTAGCTGC
>probe:Drosophila_2:1632775_at:131:119; Interrogation_Position=285; Antisense; AGCTGCACCGAAAGATGTTGCCCAA
>probe:Drosophila_2:1632775_at:208:381; Interrogation_Position=35; Antisense; GAACCTATGTCATATATCCAACATC
>probe:Drosophila_2:1632775_at:539:547; Interrogation_Position=63; Antisense; GGATGAAGAGGATTCCCACTGGAAT
>probe:Drosophila_2:1632775_at:642:561; Interrogation_Position=83; Antisense; GGAATCCGGACGTTTCCAGTGCGGA
>probe:Drosophila_2:1632775_at:201:479; Interrogation_Position=94; Antisense; GTTTCCAGTGCGGACAAGGCTACAG

Paste this into a BLAST search page for me
CTACAGATAAGATAACCGAGGCCCTAACCGAGGCCCTGATGGATTGGTGCGCGGGACATCGAAACGCACTACGATGCGGCACAAGTGCTACAGAACCTATCACTACGATTTCTTCTTGGTCTTTGTCTTCTTGGTCTTTGTCGCCTTGGAGTCGCCTTGGACAGCCAGGAGGATAGAAATTCAAGGCTACCAGGCAATACAGATGCCTGCATGTGGATTAGCTGCAGCTGCACCGAAAGATGTTGCCCAAGAACCTATGTCATATATCCAACATCGGATGAAGAGGATTCCCACTGGAATGGAATCCGGACGTTTCCAGTGCGGAGTTTCCAGTGCGGACAAGGCTACAG

Full Affymetrix probeset data:

Annotations for 1632775_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720