FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632776_at:

>probe:Drosophila_2:1632776_at:56:457; Interrogation_Position=1008; Antisense; GATACACGGCTTGATGGCTCAGATT
>probe:Drosophila_2:1632776_at:361:613; Interrogation_Position=1114; Antisense; TGAATTTTCTTTTCATTTCCCTGGG
>probe:Drosophila_2:1632776_at:489:251; Interrogation_Position=618; Antisense; CAAGGTGTGTCTGGGTGCATTCCGC
>probe:Drosophila_2:1632776_at:69:345; Interrogation_Position=634; Antisense; GCATTCCGCACGTATCCAAAAGGTT
>probe:Drosophila_2:1632776_at:681:75; Interrogation_Position=674; Antisense; AGGAGCCCTCGGAGTATCAGACCAT
>probe:Drosophila_2:1632776_at:313:103; Interrogation_Position=692; Antisense; AGACCATCCCGCTGAATAAGATCGA
>probe:Drosophila_2:1632776_at:17:213; Interrogation_Position=716; Antisense; AAGACTTTGGAGTCCACTGCAAGCA
>probe:Drosophila_2:1632776_at:59:145; Interrogation_Position=731; Antisense; ACTGCAAGCAGTACTATCCCTTGGA
>probe:Drosophila_2:1632776_at:62:677; Interrogation_Position=759; Antisense; TAGCTACTTCAAGTCTGCTCTGGAC
>probe:Drosophila_2:1632776_at:538:335; Interrogation_Position=789; Antisense; GCTCCTCGACTCTCTGTGGAACAAA
>probe:Drosophila_2:1632776_at:180:531; Interrogation_Position=840; Antisense; GGGTCTGCTCACCAACACAGAGTAC
>probe:Drosophila_2:1632776_at:232:491; Interrogation_Position=861; Antisense; GTACACCACCGGTCAGATCATGGAT
>probe:Drosophila_2:1632776_at:631:695; Interrogation_Position=918; Antisense; TTTAGGTCGCGGAACCGATGTCAAT
>probe:Drosophila_2:1632776_at:171:337; Interrogation_Position=992; Antisense; GCTCCACCATTGAACTGATACACGG

Paste this into a BLAST search page for me
GATACACGGCTTGATGGCTCAGATTTGAATTTTCTTTTCATTTCCCTGGGCAAGGTGTGTCTGGGTGCATTCCGCGCATTCCGCACGTATCCAAAAGGTTAGGAGCCCTCGGAGTATCAGACCATAGACCATCCCGCTGAATAAGATCGAAAGACTTTGGAGTCCACTGCAAGCAACTGCAAGCAGTACTATCCCTTGGATAGCTACTTCAAGTCTGCTCTGGACGCTCCTCGACTCTCTGTGGAACAAAGGGTCTGCTCACCAACACAGAGTACGTACACCACCGGTCAGATCATGGATTTTAGGTCGCGGAACCGATGTCAATGCTCCACCATTGAACTGATACACGG

Full Affymetrix probeset data:

Annotations for 1632776_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720