FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632777_at:

>probe:Drosophila_2:1632777_at:239:199; Interrogation_Position=156; Antisense; AACGCCGTTCCAGTGGAGCAGAAAC
>probe:Drosophila_2:1632777_at:581:177; Interrogation_Position=177; Antisense; AAACGGCTTGGAACCCTCGATAGAG
>probe:Drosophila_2:1632777_at:7:335; Interrogation_Position=232; Antisense; GCTGAGTTTTATTTTGCACGCGACA
>probe:Drosophila_2:1632777_at:384:307; Interrogation_Position=335; Antisense; CCTACTGCTCTGTGGCTTGTTATAA
>probe:Drosophila_2:1632777_at:19:83; Interrogation_Position=367; Antisense; AGGGATTCGCCCCAATGTGCGACAA
>probe:Drosophila_2:1632777_at:288:77; Interrogation_Position=428; Antisense; AGGAGGAACCTACGCTTCATGTGCC
>probe:Drosophila_2:1632777_at:133:409; Interrogation_Position=463; Antisense; GACGACACAGTTGCCGCGGAGAAGC
>probe:Drosophila_2:1632777_at:159:383; Interrogation_Position=511; Antisense; GAACTGCGTAATTTGCTCCACAATC
>probe:Drosophila_2:1632777_at:596:619; Interrogation_Position=551; Antisense; TGCTCCAGCAGATTGATGTGGCCAT
>probe:Drosophila_2:1632777_at:498:33; Interrogation_Position=574; Antisense; ATCAATGCCCAGTCGGCCATGATGG
>probe:Drosophila_2:1632777_at:444:53; Interrogation_Position=604; Antisense; ATGCAGGAGCCACTCTTCGTGGAGT
>probe:Drosophila_2:1632777_at:195:589; Interrogation_Position=623; Antisense; TGGAGTTCGCTAATGCCTGCCTTCA
>probe:Drosophila_2:1632777_at:429:627; Interrogation_Position=640; Antisense; TGCCTTCAAGTCGTCGAACCGATGA
>probe:Drosophila_2:1632777_at:453:201; Interrogation_Position=656; Antisense; AACCGATGACGGATGCTGAGCGCAC

Paste this into a BLAST search page for me
AACGCCGTTCCAGTGGAGCAGAAACAAACGGCTTGGAACCCTCGATAGAGGCTGAGTTTTATTTTGCACGCGACACCTACTGCTCTGTGGCTTGTTATAAAGGGATTCGCCCCAATGTGCGACAAAGGAGGAACCTACGCTTCATGTGCCGACGACACAGTTGCCGCGGAGAAGCGAACTGCGTAATTTGCTCCACAATCTGCTCCAGCAGATTGATGTGGCCATATCAATGCCCAGTCGGCCATGATGGATGCAGGAGCCACTCTTCGTGGAGTTGGAGTTCGCTAATGCCTGCCTTCATGCCTTCAAGTCGTCGAACCGATGAAACCGATGACGGATGCTGAGCGCAC

Full Affymetrix probeset data:

Annotations for 1632777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720