Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632781_s_at:

>probe:Drosophila_2:1632781_s_at:229:157; Interrogation_Position=249; Antisense; ACACCAGCAGGCCAGAGTATCTGTG
>probe:Drosophila_2:1632781_s_at:252:329; Interrogation_Position=275; Antisense; GCGTGTGTGTGTATACCTCTTAAAG
>probe:Drosophila_2:1632781_s_at:447:169; Interrogation_Position=296; Antisense; AAAGGCTGTTGTTCTGGTTTTGGCG
>probe:Drosophila_2:1632781_s_at:553:319; Interrogation_Position=345; Antisense; GCCCGAGTATTTACCACTTTACAAT
>probe:Drosophila_2:1632781_s_at:633:65; Interrogation_Position=368; Antisense; ATGGCGTTTTAGTACCGCGAGTCGT
>probe:Drosophila_2:1632781_s_at:562:299; Interrogation_Position=383; Antisense; CGCGAGTCGTCATTGTCGTCGTCAT
>probe:Drosophila_2:1632781_s_at:205:639; Interrogation_Position=398; Antisense; TCGTCGTCATCATCGCCGCATAAAG
>probe:Drosophila_2:1632781_s_at:172:181; Interrogation_Position=431; Antisense; AAAACCGCGGAGTGTCAGCCATAAA
>probe:Drosophila_2:1632781_s_at:485:663; Interrogation_Position=452; Antisense; TAAAGCACTAGTACCGCCGACTTAA
>probe:Drosophila_2:1632781_s_at:202:235; Interrogation_Position=475; Antisense; AATCCCAGTCCCGATTCGGATTAAT
>probe:Drosophila_2:1632781_s_at:371:715; Interrogation_Position=489; Antisense; TTCGGATTAATCTGCCTCAATCGCC
>probe:Drosophila_2:1632781_s_at:453:673; Interrogation_Position=537; Antisense; TACCATTCGCGGTCAAGTATCAAAT
>probe:Drosophila_2:1632781_s_at:266:649; Interrogation_Position=650; Antisense; TCAGACTTGCAGGTCACGTATTAGT
>probe:Drosophila_2:1632781_s_at:657:373; Interrogation_Position=689; Antisense; GAAGAAACTTCGCTGGATCATAAAA

Paste this into a BLAST search page for me
ACACCAGCAGGCCAGAGTATCTGTGGCGTGTGTGTGTATACCTCTTAAAGAAAGGCTGTTGTTCTGGTTTTGGCGGCCCGAGTATTTACCACTTTACAATATGGCGTTTTAGTACCGCGAGTCGTCGCGAGTCGTCATTGTCGTCGTCATTCGTCGTCATCATCGCCGCATAAAGAAAACCGCGGAGTGTCAGCCATAAATAAAGCACTAGTACCGCCGACTTAAAATCCCAGTCCCGATTCGGATTAATTTCGGATTAATCTGCCTCAATCGCCTACCATTCGCGGTCAAGTATCAAATTCAGACTTGCAGGTCACGTATTAGTGAAGAAACTTCGCTGGATCATAAAA

Full Affymetrix probeset data:

Annotations for 1632781_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime