Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632782_a_at:

>probe:Drosophila_2:1632782_a_at:497:237; Interrogation_Position=1017; Antisense; AATCTAGACGGGTGTCTGCGGCTGA
>probe:Drosophila_2:1632782_a_at:135:423; Interrogation_Position=1040; Antisense; GAGAGCCAACGCACAATTTACTGAT
>probe:Drosophila_2:1632782_a_at:205:635; Interrogation_Position=558; Antisense; TCGCATAGTCATCGTAGCCTCGGAG
>probe:Drosophila_2:1632782_a_at:166:283; Interrogation_Position=592; Antisense; CTGTCGTCGGTTAACCTGGCCAAGC
>probe:Drosophila_2:1632782_a_at:371:573; Interrogation_Position=639; Antisense; GGCTGCCTACTTATACTATGTGTCC
>probe:Drosophila_2:1632782_a_at:257:515; Interrogation_Position=658; Antisense; GTGTCCAAGTTTGCGAACATCTACT
>probe:Drosophila_2:1632782_a_at:368:189; Interrogation_Position=673; Antisense; AACATCTACTTTGCCCGGGAGCTGG
>probe:Drosophila_2:1632782_a_at:227:707; Interrogation_Position=722; Antisense; TTACAGTGAATTTCCTGCATCCCGG
>probe:Drosophila_2:1632782_a_at:288:41; Interrogation_Position=751; Antisense; ATCGACTCGGGCATTTGGCGTAACG
>probe:Drosophila_2:1632782_a_at:503:69; Interrogation_Position=802; Antisense; ATGGCCATCACCAAGGGATTCTTCA
>probe:Drosophila_2:1632782_a_at:228:103; Interrogation_Position=848; Antisense; AGACCACTATCTATTTGGCCACATC
>probe:Drosophila_2:1632782_a_at:88:67; Interrogation_Position=907; Antisense; ATGGACTGCAAGGAGGCCACCCTTA
>probe:Drosophila_2:1632782_a_at:238:51; Interrogation_Position=932; Antisense; ATGCTGCTGCCCTCGATGAGGAGAA
>probe:Drosophila_2:1632782_a_at:108:375; Interrogation_Position=984; Antisense; GAAGATTGTCAAGCTTACGCCCCAG

Paste this into a BLAST search page for me
AATCTAGACGGGTGTCTGCGGCTGAGAGAGCCAACGCACAATTTACTGATTCGCATAGTCATCGTAGCCTCGGAGCTGTCGTCGGTTAACCTGGCCAAGCGGCTGCCTACTTATACTATGTGTCCGTGTCCAAGTTTGCGAACATCTACTAACATCTACTTTGCCCGGGAGCTGGTTACAGTGAATTTCCTGCATCCCGGATCGACTCGGGCATTTGGCGTAACGATGGCCATCACCAAGGGATTCTTCAAGACCACTATCTATTTGGCCACATCATGGACTGCAAGGAGGCCACCCTTAATGCTGCTGCCCTCGATGAGGAGAAGAAGATTGTCAAGCTTACGCCCCAG

Full Affymetrix probeset data:

Annotations for 1632782_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime