FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632784_at:

>probe:Drosophila_2:1632784_at:231:387; Interrogation_Position=4827; Antisense; GAAAACTATTGTGAATGCTCGCGGG
>probe:Drosophila_2:1632784_at:273:327; Interrogation_Position=4919; Antisense; GCGATATTCTCGTACGATTTAGGTA
>probe:Drosophila_2:1632784_at:80:603; Interrogation_Position=4951; Antisense; TGTTCATTTTGATCGTCTTCCCTGT
>probe:Drosophila_2:1632784_at:606:673; Interrogation_Position=5002; Antisense; TACCTGCAATCCCTTCGATTCGAAA
>probe:Drosophila_2:1632784_at:419:715; Interrogation_Position=5015; Antisense; TTCGATTCGAAACCCACTTAGATGT
>probe:Drosophila_2:1632784_at:669:477; Interrogation_Position=5044; Antisense; GTTTAATCTGCCTTATTTGCATTGT
>probe:Drosophila_2:1632784_at:605:273; Interrogation_Position=5063; Antisense; CATTGTATTTCGGTTCTAGGCAAAA
>probe:Drosophila_2:1632784_at:41:699; Interrogation_Position=5091; Antisense; TTTACACATGTAGTCACGCAAGCAA
>probe:Drosophila_2:1632784_at:77:211; Interrogation_Position=5171; Antisense; AAGACGGTTCTTTATGATTTGCCTT
>probe:Drosophila_2:1632784_at:477:19; Interrogation_Position=5187; Antisense; ATTTGCCTTTGTACGCGATTAACCA
>probe:Drosophila_2:1632784_at:689:203; Interrogation_Position=5207; Antisense; AACCAAGTTAATCCGAGCTGTTTGA
>probe:Drosophila_2:1632784_at:551:457; Interrogation_Position=5230; Antisense; GATTTGCTCAACAGTTTGTGTCTAG
>probe:Drosophila_2:1632784_at:98:691; Interrogation_Position=5297; Antisense; TATTGTAATGGCATCCAGCGACGCC
>probe:Drosophila_2:1632784_at:552:261; Interrogation_Position=5312; Antisense; CAGCGACGCCAATGGAGCCAGAAAT

Paste this into a BLAST search page for me
GAAAACTATTGTGAATGCTCGCGGGGCGATATTCTCGTACGATTTAGGTATGTTCATTTTGATCGTCTTCCCTGTTACCTGCAATCCCTTCGATTCGAAATTCGATTCGAAACCCACTTAGATGTGTTTAATCTGCCTTATTTGCATTGTCATTGTATTTCGGTTCTAGGCAAAATTTACACATGTAGTCACGCAAGCAAAAGACGGTTCTTTATGATTTGCCTTATTTGCCTTTGTACGCGATTAACCAAACCAAGTTAATCCGAGCTGTTTGAGATTTGCTCAACAGTTTGTGTCTAGTATTGTAATGGCATCCAGCGACGCCCAGCGACGCCAATGGAGCCAGAAAT

Full Affymetrix probeset data:

Annotations for 1632784_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720