Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632787_a_at:

>probe:Drosophila_2:1632787_a_at:190:373; Interrogation_Position=1062; Antisense; GAAGAGTCATCCGTGGTTCCAGGGC
>probe:Drosophila_2:1632787_a_at:486:695; Interrogation_Position=1142; Antisense; TTTCCGGCGCCGAAGATCTGTCGAA
>probe:Drosophila_2:1632787_a_at:472:489; Interrogation_Position=1194; Antisense; GTACAAGTCCCGAATAAACCGCCAT
>probe:Drosophila_2:1632787_a_at:604:299; Interrogation_Position=1213; Antisense; CGCCATCCCGAATTGTTTGCGAATT
>probe:Drosophila_2:1632787_a_at:409:493; Interrogation_Position=1245; Antisense; GTCAATGTGTCCTTCGAAATCGTCG
>probe:Drosophila_2:1632787_a_at:231:93; Interrogation_Position=1329; Antisense; AGTTTTCGCAATACAGCTCTCTTAT
>probe:Drosophila_2:1632787_a_at:234:31; Interrogation_Position=773; Antisense; ATCAACGCTGTGTGGAACCCCGGAA
>probe:Drosophila_2:1632787_a_at:566:665; Interrogation_Position=798; Antisense; TACTTGGCCCCGGAGATTGTTCAAC
>probe:Drosophila_2:1632787_a_at:395:515; Interrogation_Position=853; Antisense; GGGCCTTTGGTATCCTAGTGTACGA
>probe:Drosophila_2:1632787_a_at:461:633; Interrogation_Position=896; Antisense; TCCCTTTGCCATTCACAATCGAGAT
>probe:Drosophila_2:1632787_a_at:519:487; Interrogation_Position=932; Antisense; GTACTCCAAGATCTGCATATGCGAC
>probe:Drosophila_2:1632787_a_at:137:25; Interrogation_Position=948; Antisense; ATATGCGACTACAAGATGCCCTCAT
>probe:Drosophila_2:1632787_a_at:607:271; Interrogation_Position=970; Antisense; CATACTTTACGTCCCAGCTGAGGAG
>probe:Drosophila_2:1632787_a_at:416:75; Interrogation_Position=990; Antisense; AGGAGCCTTGTCGAGAGCCTCATGC

Paste this into a BLAST search page for me
GAAGAGTCATCCGTGGTTCCAGGGCTTTCCGGCGCCGAAGATCTGTCGAAGTACAAGTCCCGAATAAACCGCCATCGCCATCCCGAATTGTTTGCGAATTGTCAATGTGTCCTTCGAAATCGTCGAGTTTTCGCAATACAGCTCTCTTATATCAACGCTGTGTGGAACCCCGGAATACTTGGCCCCGGAGATTGTTCAACGGGCCTTTGGTATCCTAGTGTACGATCCCTTTGCCATTCACAATCGAGATGTACTCCAAGATCTGCATATGCGACATATGCGACTACAAGATGCCCTCATCATACTTTACGTCCCAGCTGAGGAGAGGAGCCTTGTCGAGAGCCTCATGC

Full Affymetrix probeset data:

Annotations for 1632787_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime