Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632788_at:

>probe:Drosophila_2:1632788_at:258:63; Interrogation_Position=13; Antisense; ATGGTTAGGCAATTGTGGATTACAA
>probe:Drosophila_2:1632788_at:617:519; Interrogation_Position=27; Antisense; GTGGATTACAACATGCATTAAGCTC
>probe:Drosophila_2:1632788_at:551:53; Interrogation_Position=39; Antisense; ATGCATTAAGCTCAAGTGTCTCCGG
>probe:Drosophila_2:1632788_at:219:345; Interrogation_Position=41; Antisense; GCATTAAGCTCAAGTGTCTCCGGCA
>probe:Drosophila_2:1632788_at:15:15; Interrogation_Position=43; Antisense; ATTAAGCTCAAGTGTCTCCGGCATC
>probe:Drosophila_2:1632788_at:730:657; Interrogation_Position=45; Antisense; TAAGCTCAAGTGTCTCCGGCATCGA
>probe:Drosophila_2:1632788_at:488:339; Interrogation_Position=48; Antisense; GCTCAAGTGTCTCCGGCATCGACTA
>probe:Drosophila_2:1632788_at:224:219; Interrogation_Position=52; Antisense; AAGTGTCTCCGGCATCGACTACTTT
>probe:Drosophila_2:1632788_at:479:631; Interrogation_Position=59; Antisense; TCCGGCATCGACTACTTTCATGTTG
>probe:Drosophila_2:1632788_at:66:289; Interrogation_Position=61; Antisense; CGGCATCGACTACTTTCATGTTGTA
>probe:Drosophila_2:1632788_at:192:149; Interrogation_Position=72; Antisense; ACTTTCATGTTGTAACTCGAGGACT
>probe:Drosophila_2:1632788_at:231:643; Interrogation_Position=76; Antisense; TCATGTTGTAACTCGAGGACTTTCG
>probe:Drosophila_2:1632788_at:219:491; Interrogation_Position=83; Antisense; GTAACTCGAGGACTTTCGGTGACCT
>probe:Drosophila_2:1632788_at:504:433; Interrogation_Position=90; Antisense; GAGGACTTTCGGTGACCTCCTGGTA

Paste this into a BLAST search page for me
ATGGTTAGGCAATTGTGGATTACAAGTGGATTACAACATGCATTAAGCTCATGCATTAAGCTCAAGTGTCTCCGGGCATTAAGCTCAAGTGTCTCCGGCAATTAAGCTCAAGTGTCTCCGGCATCTAAGCTCAAGTGTCTCCGGCATCGAGCTCAAGTGTCTCCGGCATCGACTAAAGTGTCTCCGGCATCGACTACTTTTCCGGCATCGACTACTTTCATGTTGCGGCATCGACTACTTTCATGTTGTAACTTTCATGTTGTAACTCGAGGACTTCATGTTGTAACTCGAGGACTTTCGGTAACTCGAGGACTTTCGGTGACCTGAGGACTTTCGGTGACCTCCTGGTA

Full Affymetrix probeset data:

Annotations for 1632788_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime