Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632790_at:

>probe:Drosophila_2:1632790_at:289:445; Interrogation_Position=1658; Antisense; GATGAATGTGCGTCAAGTGGTTAAA
>probe:Drosophila_2:1632790_at:456:473; Interrogation_Position=1677; Antisense; GTTAAAATGCAATCCAAAGACCGCC
>probe:Drosophila_2:1632790_at:276:171; Interrogation_Position=1692; Antisense; AAAGACCGCCAAATTCCATCTGTCA
>probe:Drosophila_2:1632790_at:598:9; Interrogation_Position=1704; Antisense; ATTCCATCTGTCACTAGCACTCTTA
>probe:Drosophila_2:1632790_at:567:95; Interrogation_Position=1719; Antisense; AGCACTCTTACCTCTAAGTACGTTT
>probe:Drosophila_2:1632790_at:73:23; Interrogation_Position=1847; Antisense; ATATAGCACATAGCGTCTGGTCCAC
>probe:Drosophila_2:1632790_at:654:151; Interrogation_Position=1854; Antisense; ACATAGCGTCTGGTCCACGTAGTGA
>probe:Drosophila_2:1632790_at:429:503; Interrogation_Position=1866; Antisense; GTCCACGTAGTGACGAAGCGTACCA
>probe:Drosophila_2:1632790_at:658:385; Interrogation_Position=1917; Antisense; GAAAATTTGCGATGGTTGTCCGATC
>probe:Drosophila_2:1632790_at:598:541; Interrogation_Position=1930; Antisense; GGTTGTCCGATCTTAGCTTAATATA
>probe:Drosophila_2:1632790_at:257:161; Interrogation_Position=1955; Antisense; ACAATCGAGAGGTAGCTCACAAACT
>probe:Drosophila_2:1632790_at:452:571; Interrogation_Position=2101; Antisense; TGGTCGATTTTTTAAGAACGGTCAT
>probe:Drosophila_2:1632790_at:204:381; Interrogation_Position=2116; Antisense; GAACGGTCATCGCATGTAAAATGTT
>probe:Drosophila_2:1632790_at:691:57; Interrogation_Position=2136; Antisense; ATGTTAAACCGTGTGCCCTTGAAAT

Paste this into a BLAST search page for me
GATGAATGTGCGTCAAGTGGTTAAAGTTAAAATGCAATCCAAAGACCGCCAAAGACCGCCAAATTCCATCTGTCAATTCCATCTGTCACTAGCACTCTTAAGCACTCTTACCTCTAAGTACGTTTATATAGCACATAGCGTCTGGTCCACACATAGCGTCTGGTCCACGTAGTGAGTCCACGTAGTGACGAAGCGTACCAGAAAATTTGCGATGGTTGTCCGATCGGTTGTCCGATCTTAGCTTAATATAACAATCGAGAGGTAGCTCACAAACTTGGTCGATTTTTTAAGAACGGTCATGAACGGTCATCGCATGTAAAATGTTATGTTAAACCGTGTGCCCTTGAAAT

Full Affymetrix probeset data:

Annotations for 1632790_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime