FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632791_at:

>probe:Drosophila_2:1632791_at:430:685; Interrogation_Position=5864; Antisense; TATACGGCTTTTCTAGACCACTACT
>probe:Drosophila_2:1632791_at:667:413; Interrogation_Position=5879; Antisense; GACCACTACTGCATGTTGCATTGCA
>probe:Drosophila_2:1632791_at:196:339; Interrogation_Position=5917; Antisense; GTAAGTTAACAACGCGTTCATTTTG
>probe:Drosophila_2:1632791_at:410:27; Interrogation_Position=5970; Antisense; ATACGTAATCAGTTAGGCGAGCAGA
>probe:Drosophila_2:1632791_at:678:575; Interrogation_Position=5985; Antisense; GGCGAGCAGATTCATATATACACAA
>probe:Drosophila_2:1632791_at:570:699; Interrogation_Position=6041; Antisense; TTTTAGGGATTGTCTCCCCGGCTTG
>probe:Drosophila_2:1632791_at:220:633; Interrogation_Position=6055; Antisense; TCCCCGGCTTGGATGCGATGTTTGC
>probe:Drosophila_2:1632791_at:425:479; Interrogation_Position=6074; Antisense; GTTTGCCTTCATGATATTCGAGTCC
>probe:Drosophila_2:1632791_at:170:293; Interrogation_Position=6092; Antisense; CGAGTCCTTAACTTTCTTTTCTCAG
>probe:Drosophila_2:1632791_at:351:187; Interrogation_Position=6101; Antisense; AACTTTCTTTTCTCAGACCTAGAGC
>probe:Drosophila_2:1632791_at:441:413; Interrogation_Position=6116; Antisense; GACCTAGAGCATTTAGTTTGTACAT
>probe:Drosophila_2:1632791_at:274:41; Interrogation_Position=6204; Antisense; ATCGGGTACGAACTAAAGCTAATCA
>probe:Drosophila_2:1632791_at:80:443; Interrogation_Position=6245; Antisense; GATGTCTTACAAACGTATACACCCA
>probe:Drosophila_2:1632791_at:382:91; Interrogation_Position=6318; Antisense; AGATATCGTGCCAATGTTAAAACAT

Paste this into a BLAST search page for me
TATACGGCTTTTCTAGACCACTACTGACCACTACTGCATGTTGCATTGCAGTAAGTTAACAACGCGTTCATTTTGATACGTAATCAGTTAGGCGAGCAGAGGCGAGCAGATTCATATATACACAATTTTAGGGATTGTCTCCCCGGCTTGTCCCCGGCTTGGATGCGATGTTTGCGTTTGCCTTCATGATATTCGAGTCCCGAGTCCTTAACTTTCTTTTCTCAGAACTTTCTTTTCTCAGACCTAGAGCGACCTAGAGCATTTAGTTTGTACATATCGGGTACGAACTAAAGCTAATCAGATGTCTTACAAACGTATACACCCAAGATATCGTGCCAATGTTAAAACAT

Full Affymetrix probeset data:

Annotations for 1632791_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720