FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632793_at:

>probe:Drosophila_2:1632793_at:534:9; Interrogation_Position=1541; Antisense; ATTCCCCGGCGGAATTGTACCGCTG
>probe:Drosophila_2:1632793_at:677:139; Interrogation_Position=1599; Antisense; ACGGGTATAGCCTCGCCGCAGATTC
>probe:Drosophila_2:1632793_at:11:105; Interrogation_Position=1645; Antisense; AGACGCCGTCGGAGGTGCCACCACA
>probe:Drosophila_2:1632793_at:110:113; Interrogation_Position=1684; Antisense; AGCAGCCCTGGAAGCCGGTATTCTA
>probe:Drosophila_2:1632793_at:18:203; Interrogation_Position=1695; Antisense; AAGCCGGTATTCTATAGTCCACCCA
>probe:Drosophila_2:1632793_at:612:371; Interrogation_Position=1777; Antisense; GAAGTGCGCCAGCTGAAGGTTACCT
>probe:Drosophila_2:1632793_at:323:611; Interrogation_Position=1790; Antisense; TGAAGGTTACCTGCCACCCGTGGGA
>probe:Drosophila_2:1632793_at:718:305; Interrogation_Position=1829; Antisense; CCTGAGTGCCAGTAGTGCCGGAATC
>probe:Drosophila_2:1632793_at:529:237; Interrogation_Position=1850; Antisense; AATCGGTGGTCAGGGCGGCATCTTT
>probe:Drosophila_2:1632793_at:615:35; Interrogation_Position=1869; Antisense; ATCTTTGACCAGCTGACCGATGCCG
>probe:Drosophila_2:1632793_at:542:447; Interrogation_Position=1887; Antisense; GATGCCGAGCTGGAGCACATTTTCG
>probe:Drosophila_2:1632793_at:401:647; Interrogation_Position=2010; Antisense; TCACTCCACCTAGGGATCTTTTCAA
>probe:Drosophila_2:1632793_at:235:659; Interrogation_Position=2057; Antisense; TAAGCCTTCGTTCATTTGTGCTCTA
>probe:Drosophila_2:1632793_at:424:473; Interrogation_Position=2066; Antisense; GTTCATTTGTGCTCTACTTGTATTG

Paste this into a BLAST search page for me
ATTCCCCGGCGGAATTGTACCGCTGACGGGTATAGCCTCGCCGCAGATTCAGACGCCGTCGGAGGTGCCACCACAAGCAGCCCTGGAAGCCGGTATTCTAAAGCCGGTATTCTATAGTCCACCCAGAAGTGCGCCAGCTGAAGGTTACCTTGAAGGTTACCTGCCACCCGTGGGACCTGAGTGCCAGTAGTGCCGGAATCAATCGGTGGTCAGGGCGGCATCTTTATCTTTGACCAGCTGACCGATGCCGGATGCCGAGCTGGAGCACATTTTCGTCACTCCACCTAGGGATCTTTTCAATAAGCCTTCGTTCATTTGTGCTCTAGTTCATTTGTGCTCTACTTGTATTG

Full Affymetrix probeset data:

Annotations for 1632793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720