Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632798_at:

>probe:Drosophila_2:1632798_at:529:161; Interrogation_Position=1288; Antisense; ACAAGGACCTCATTCTGATCCTGCG
>probe:Drosophila_2:1632798_at:41:85; Interrogation_Position=1346; Antisense; AGTGGATCCCAAGCGCATCGTGAAG
>probe:Drosophila_2:1632798_at:41:323; Interrogation_Position=1370; Antisense; GCGCCTTAAGATACTGTACTCCGTG
>probe:Drosophila_2:1632798_at:38:543; Interrogation_Position=1424; Antisense; GGATAATCTGGAGCCCGATTCCTCA
>probe:Drosophila_2:1632798_at:617:463; Interrogation_Position=1440; Antisense; GATTCCTCAGTTGCTTCCGAAGCTC
>probe:Drosophila_2:1632798_at:656:631; Interrogation_Position=1455; Antisense; TCCGAAGCTCAAGTGCCCTCAAGTG
>probe:Drosophila_2:1632798_at:508:131; Interrogation_Position=1482; Antisense; ACCCGAACTTTTGTGCGGAGCAGTC
>probe:Drosophila_2:1632798_at:100:331; Interrogation_Position=1496; Antisense; GCGGAGCAGTCGATCCTTTGGCAAA
>probe:Drosophila_2:1632798_at:410:565; Interrogation_Position=1515; Antisense; GGCAAACGGCATCGATCCTTTGTAA
>probe:Drosophila_2:1632798_at:699:161; Interrogation_Position=1550; Antisense; AAATTGCTCAGTTTTCGGGCCACAG
>probe:Drosophila_2:1632798_at:313:75; Interrogation_Position=1573; Antisense; AGGACTCACTTGCTGAATCCGGACA
>probe:Drosophila_2:1632798_at:457:233; Interrogation_Position=1588; Antisense; AATCCGGACACAGCGAAAGCGATCT
>probe:Drosophila_2:1632798_at:329:523; Interrogation_Position=1656; Antisense; GGGCGAGCCATATTCTAAATACGCG
>probe:Drosophila_2:1632798_at:541:241; Interrogation_Position=1673; Antisense; AATACGCGGGCTTATCTGTATGAGA

Paste this into a BLAST search page for me
ACAAGGACCTCATTCTGATCCTGCGAGTGGATCCCAAGCGCATCGTGAAGGCGCCTTAAGATACTGTACTCCGTGGGATAATCTGGAGCCCGATTCCTCAGATTCCTCAGTTGCTTCCGAAGCTCTCCGAAGCTCAAGTGCCCTCAAGTGACCCGAACTTTTGTGCGGAGCAGTCGCGGAGCAGTCGATCCTTTGGCAAAGGCAAACGGCATCGATCCTTTGTAAAAATTGCTCAGTTTTCGGGCCACAGAGGACTCACTTGCTGAATCCGGACAAATCCGGACACAGCGAAAGCGATCTGGGCGAGCCATATTCTAAATACGCGAATACGCGGGCTTATCTGTATGAGA

Full Affymetrix probeset data:

Annotations for 1632798_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime