FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632800_at:

>probe:Drosophila_2:1632800_at:629:273; Interrogation_Position=110; Antisense; CATTCTACTACGTACCATTGGTGTA
>probe:Drosophila_2:1632800_at:63:389; Interrogation_Position=139; Antisense; GAAAACATTGCCTTGGGACGCCATC
>probe:Drosophila_2:1632800_at:365:121; Interrogation_Position=193; Antisense; AGCTGGCAATTCTTTGAGGTCCTTT
>probe:Drosophila_2:1632800_at:425:435; Interrogation_Position=208; Antisense; GAGGTCCTTTTCAGACATCATCTGG
>probe:Drosophila_2:1632800_at:310:693; Interrogation_Position=24; Antisense; TTTGCACAACGTTCTGCTGTACTAC
>probe:Drosophila_2:1632800_at:246:361; Interrogation_Position=275; Antisense; GCAAGTTGGCCTTCATTAGCACACT
>probe:Drosophila_2:1632800_at:412:707; Interrogation_Position=290; Antisense; TTAGCACACTGGTTCTCTTGTCGAA
>probe:Drosophila_2:1632800_at:290:385; Interrogation_Position=312; Antisense; GAACTTTGTGCTGTTCGTCTGTTTC
>probe:Drosophila_2:1632800_at:215:273; Interrogation_Position=345; Antisense; CATTTGTCAGCTGTTGTGGGTCCAT
>probe:Drosophila_2:1632800_at:644:161; Interrogation_Position=397; Antisense; ACAATCATGTGTTTGGGCCCCGTTT
>probe:Drosophila_2:1632800_at:636:595; Interrogation_Position=458; Antisense; TGTGGCTCAGTCAGTGGATTCTTGT
>probe:Drosophila_2:1632800_at:617:23; Interrogation_Position=56; Antisense; ATATGTTCAAGCATTTGGCCCAGGC
>probe:Drosophila_2:1632800_at:96:729; Interrogation_Position=70; Antisense; TTGGCCCAGGCATCGATTAACTCGG
>probe:Drosophila_2:1632800_at:605:405; Interrogation_Position=94; Antisense; GACGGACCGGTGAACACATTCTACT

Paste this into a BLAST search page for me
CATTCTACTACGTACCATTGGTGTAGAAAACATTGCCTTGGGACGCCATCAGCTGGCAATTCTTTGAGGTCCTTTGAGGTCCTTTTCAGACATCATCTGGTTTGCACAACGTTCTGCTGTACTACGCAAGTTGGCCTTCATTAGCACACTTTAGCACACTGGTTCTCTTGTCGAAGAACTTTGTGCTGTTCGTCTGTTTCCATTTGTCAGCTGTTGTGGGTCCATACAATCATGTGTTTGGGCCCCGTTTTGTGGCTCAGTCAGTGGATTCTTGTATATGTTCAAGCATTTGGCCCAGGCTTGGCCCAGGCATCGATTAACTCGGGACGGACCGGTGAACACATTCTACT

Full Affymetrix probeset data:

Annotations for 1632800_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720