FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632802_at:

>probe:Drosophila_2:1632802_at:46:719; Interrogation_Position=1011; Antisense; TTCGAGGCCATCTTCTGTGAATACA
>probe:Drosophila_2:1632802_at:166:511; Interrogation_Position=1027; Antisense; GTGAATACACCTTGGCGCTTCATAA
>probe:Drosophila_2:1632802_at:403:433; Interrogation_Position=1077; Antisense; GAGGTTCCGGATTTCCTAAGTCGCG
>probe:Drosophila_2:1632802_at:411:627; Interrogation_Position=1090; Antisense; TCCTAAGTCGCGGTGAGCTTCTGAA
>probe:Drosophila_2:1632802_at:30:371; Interrogation_Position=1112; Antisense; GAAGGAGTACGTGCGTTTCCTGCCG
>probe:Drosophila_2:1632802_at:245:491; Interrogation_Position=1136; Antisense; GTACAGCTTATCCATATCGGCCAGT
>probe:Drosophila_2:1632802_at:386:41; Interrogation_Position=1151; Antisense; ATCGGCCAGTTTCCTCATGAGTTTG
>probe:Drosophila_2:1632802_at:225:603; Interrogation_Position=1168; Antisense; TGAGTTTGGTGGATCCCTTGGACAT
>probe:Drosophila_2:1632802_at:341:99; Interrogation_Position=1204; Antisense; AGATGTTCGCCTTGCAACTGTCTGA
>probe:Drosophila_2:1632802_at:202:399; Interrogation_Position=1275; Antisense; GACAGGGAGGTTGCTCACCAGGTTA
>probe:Drosophila_2:1632802_at:681:601; Interrogation_Position=916; Antisense; TGTTCGACTACCAGACATTGCGAGT
>probe:Drosophila_2:1632802_at:472:65; Interrogation_Position=951; Antisense; ATGGTCGATCTCAACGTCTTTCTAG
>probe:Drosophila_2:1632802_at:567:123; Interrogation_Position=974; Antisense; AGCCGTGTCCATTTTTGCCGAGGTA
>probe:Drosophila_2:1632802_at:427:435; Interrogation_Position=993; Antisense; GAGGTACGCGATCCAAACTTCGAGG

Paste this into a BLAST search page for me
TTCGAGGCCATCTTCTGTGAATACAGTGAATACACCTTGGCGCTTCATAAGAGGTTCCGGATTTCCTAAGTCGCGTCCTAAGTCGCGGTGAGCTTCTGAAGAAGGAGTACGTGCGTTTCCTGCCGGTACAGCTTATCCATATCGGCCAGTATCGGCCAGTTTCCTCATGAGTTTGTGAGTTTGGTGGATCCCTTGGACATAGATGTTCGCCTTGCAACTGTCTGAGACAGGGAGGTTGCTCACCAGGTTATGTTCGACTACCAGACATTGCGAGTATGGTCGATCTCAACGTCTTTCTAGAGCCGTGTCCATTTTTGCCGAGGTAGAGGTACGCGATCCAAACTTCGAGG

Full Affymetrix probeset data:

Annotations for 1632802_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720