FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632803_at:

>probe:Drosophila_2:1632803_at:325:99; Interrogation_Position=428; Antisense; AGATGCTCGAGCTGCTTGAGAACTC
>probe:Drosophila_2:1632803_at:584:379; Interrogation_Position=453; Antisense; GAACGAGATCGACCTGGCGGTCATC
>probe:Drosophila_2:1632803_at:407:451; Interrogation_Position=496; Antisense; GATCTCGTCGAGACCTTCGAGGTGA
>probe:Drosophila_2:1632803_at:298:603; Interrogation_Position=534; Antisense; TGTTCTGGCCTTCAGGAACGGCGTC
>probe:Drosophila_2:1632803_at:393:215; Interrogation_Position=568; Antisense; AAGTTCATTGGTCTGGTCGACGCCA
>probe:Drosophila_2:1632803_at:521:421; Interrogation_Position=601; Antisense; GAGACCCTAATCGACAAACTGAAGC
>probe:Drosophila_2:1632803_at:426:529; Interrogation_Position=690; Antisense; GGGATGCTATGATTTTACACACGAA
>probe:Drosophila_2:1632803_at:716:189; Interrogation_Position=727; Antisense; AACTGCGATATGAAGCCCAATGCCG
>probe:Drosophila_2:1632803_at:584:583; Interrogation_Position=829; Antisense; TGGCTACTCTTAATTCACACTTCGT
>probe:Drosophila_2:1632803_at:121:651; Interrogation_Position=843; Antisense; TCACACTTCGTCCACAATCGATTTA
>probe:Drosophila_2:1632803_at:476:545; Interrogation_Position=878; Antisense; GGATCGCTTTATTGTTTGGTTGGTT
>probe:Drosophila_2:1632803_at:188:191; Interrogation_Position=920; Antisense; AACTTGGTCCACATCTGGTTGTTAT
>probe:Drosophila_2:1632803_at:212:589; Interrogation_Position=935; Antisense; TGGTTGTTATCTGACAGCTTCCCCA
>probe:Drosophila_2:1632803_at:450:689; Interrogation_Position=953; Antisense; TTCCCCAGACGAGGTTCCAATTACA

Paste this into a BLAST search page for me
AGATGCTCGAGCTGCTTGAGAACTCGAACGAGATCGACCTGGCGGTCATCGATCTCGTCGAGACCTTCGAGGTGATGTTCTGGCCTTCAGGAACGGCGTCAAGTTCATTGGTCTGGTCGACGCCAGAGACCCTAATCGACAAACTGAAGCGGGATGCTATGATTTTACACACGAAAACTGCGATATGAAGCCCAATGCCGTGGCTACTCTTAATTCACACTTCGTTCACACTTCGTCCACAATCGATTTAGGATCGCTTTATTGTTTGGTTGGTTAACTTGGTCCACATCTGGTTGTTATTGGTTGTTATCTGACAGCTTCCCCATTCCCCAGACGAGGTTCCAATTACA

Full Affymetrix probeset data:

Annotations for 1632803_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720