FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632804_at:

>probe:Drosophila_2:1632804_at:112:295; Interrogation_Position=1418; Antisense; CGAGGCGTTCGCTAAATTTGCCAGA
>probe:Drosophila_2:1632804_at:527:313; Interrogation_Position=1437; Antisense; GCCAGAGATGGCTCAGATCGTACTA
>probe:Drosophila_2:1632804_at:221:71; Interrogation_Position=1463; Antisense; AGGCCGCGATATAGTCGTCTACTTG
>probe:Drosophila_2:1632804_at:388:75; Interrogation_Position=1504; Antisense; AGGACGTGCAAGTGCTGCGCAATCT
>probe:Drosophila_2:1632804_at:580:627; Interrogation_Position=1551; Antisense; TGCCATATACCATTGCTGCACGTGA
>probe:Drosophila_2:1632804_at:484:209; Interrogation_Position=1575; Antisense; AAGCAGTGTCTGGAGTACTTACGCA
>probe:Drosophila_2:1632804_at:159:325; Interrogation_Position=1629; Antisense; GCGAACATACACTTGCTGCTTTATC
>probe:Drosophila_2:1632804_at:667:333; Interrogation_Position=1643; Antisense; GCTGCTTTATCCCATCAAACGTATT
>probe:Drosophila_2:1632804_at:233:181; Interrogation_Position=1673; Antisense; AAAAATGCTCCTTTTGCAATCACCC
>probe:Drosophila_2:1632804_at:44:359; Interrogation_Position=1688; Antisense; GCAATCACCCGATGCGCAAGAAGAT
>probe:Drosophila_2:1632804_at:616:395; Interrogation_Position=1755; Antisense; GAAATTCTGACTCTCATTCTCTACC
>probe:Drosophila_2:1632804_at:390:237; Interrogation_Position=1786; Antisense; AATCGGAGTTCCACTTCACGGGCGA
>probe:Drosophila_2:1632804_at:415:423; Interrogation_Position=1845; Antisense; GAGAACTTCAACAATCTACTGCCCG
>probe:Drosophila_2:1632804_at:62:317; Interrogation_Position=1937; Antisense; GCGCTTGTAGGTGCCTCCAATATAA

Paste this into a BLAST search page for me
CGAGGCGTTCGCTAAATTTGCCAGAGCCAGAGATGGCTCAGATCGTACTAAGGCCGCGATATAGTCGTCTACTTGAGGACGTGCAAGTGCTGCGCAATCTTGCCATATACCATTGCTGCACGTGAAAGCAGTGTCTGGAGTACTTACGCAGCGAACATACACTTGCTGCTTTATCGCTGCTTTATCCCATCAAACGTATTAAAAATGCTCCTTTTGCAATCACCCGCAATCACCCGATGCGCAAGAAGATGAAATTCTGACTCTCATTCTCTACCAATCGGAGTTCCACTTCACGGGCGAGAGAACTTCAACAATCTACTGCCCGGCGCTTGTAGGTGCCTCCAATATAA

Full Affymetrix probeset data:

Annotations for 1632804_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720