FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632805_at:

>probe:Drosophila_2:1632805_at:727:229; Interrogation_Position=1018; Antisense; AATGGGCTCCTCCTAGAGAAGCGCC
>probe:Drosophila_2:1632805_at:149:125; Interrogation_Position=1074; Antisense; AGCGCCATCGATTAGTGATACCCAC
>probe:Drosophila_2:1632805_at:126:277; Interrogation_Position=1099; Antisense; TCCTAGTTAACTGCTCGACCGAATA
>probe:Drosophila_2:1632805_at:117:81; Interrogation_Position=606; Antisense; AGGTCCTCATCTTCCTGATATGGAG
>probe:Drosophila_2:1632805_at:279:25; Interrogation_Position=623; Antisense; ATATGGAGCGAGGTCGTGCCTCACT
>probe:Drosophila_2:1632805_at:53:507; Interrogation_Position=638; Antisense; GTGCCTCACTGTCTGACCAATATGG
>probe:Drosophila_2:1632805_at:390:377; Interrogation_Position=673; Antisense; GAAGCTGACCAAGATCGCGGCCACT
>probe:Drosophila_2:1632805_at:622:63; Interrogation_Position=728; Antisense; ATGGGTCTGACGTACATTTGCGAGA
>probe:Drosophila_2:1632805_at:25:681; Interrogation_Position=805; Antisense; TATGTTGAAGTTTCCATGCCTCCGG
>probe:Drosophila_2:1632805_at:534:323; Interrogation_Position=847; Antisense; GCGCTGCTATCTACTACTTACGGAA
>probe:Drosophila_2:1632805_at:580:667; Interrogation_Position=861; Antisense; TACTTACGGAAAATGCGCGCGCTCG
>probe:Drosophila_2:1632805_at:444:323; Interrogation_Position=877; Antisense; GCGCGCTCGCAGTGCACTTAGAGTG
>probe:Drosophila_2:1632805_at:255:149; Interrogation_Position=892; Antisense; ACTTAGAGTGTGTCTGCCGGATCTG
>probe:Drosophila_2:1632805_at:722:611; Interrogation_Position=952; Antisense; TGACACGTGCACCAAGCAGTGGCTG

Paste this into a BLAST search page for me
AATGGGCTCCTCCTAGAGAAGCGCCAGCGCCATCGATTAGTGATACCCACTCCTAGTTAACTGCTCGACCGAATAAGGTCCTCATCTTCCTGATATGGAGATATGGAGCGAGGTCGTGCCTCACTGTGCCTCACTGTCTGACCAATATGGGAAGCTGACCAAGATCGCGGCCACTATGGGTCTGACGTACATTTGCGAGATATGTTGAAGTTTCCATGCCTCCGGGCGCTGCTATCTACTACTTACGGAATACTTACGGAAAATGCGCGCGCTCGGCGCGCTCGCAGTGCACTTAGAGTGACTTAGAGTGTGTCTGCCGGATCTGTGACACGTGCACCAAGCAGTGGCTG

Full Affymetrix probeset data:

Annotations for 1632805_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720