Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632807_at:

>probe:Drosophila_2:1632807_at:240:511; Interrogation_Position=2614; Antisense; GTGACTAGCGAAATCGATCCATCCT
>probe:Drosophila_2:1632807_at:265:637; Interrogation_Position=2627; Antisense; TCGATCCATCCTTGAGTGTTAGTGT
>probe:Drosophila_2:1632807_at:613:433; Interrogation_Position=2640; Antisense; GAGTGTTAGTGTATCCGAGTGCATA
>probe:Drosophila_2:1632807_at:20:485; Interrogation_Position=2650; Antisense; GTATCCGAGTGCATAGAGAATCTTA
>probe:Drosophila_2:1632807_at:261:459; Interrogation_Position=2688; Antisense; GATATTTTATGTCCAGTTCGCTATG
>probe:Drosophila_2:1632807_at:410:317; Interrogation_Position=2795; Antisense; GCCGGTTAGTGTTAGATCCCATCGA
>probe:Drosophila_2:1632807_at:159:35; Interrogation_Position=2827; Antisense; ATCACATATATTTTTAGCCGAGGAA
>probe:Drosophila_2:1632807_at:336:709; Interrogation_Position=2930; Antisense; TTAAGTCAATTTTCACACGCATAAA
>probe:Drosophila_2:1632807_at:130:665; Interrogation_Position=2970; Antisense; TACACTAGAGTGTTGAACGCATTTT
>probe:Drosophila_2:1632807_at:650:473; Interrogation_Position=3030; Antisense; GTTAAGTTTGTTTCAGTTTCTGTAT
>probe:Drosophila_2:1632807_at:721:467; Interrogation_Position=3060; Antisense; GTTGTTTATGCTCATCAACCCTGCA
>probe:Drosophila_2:1632807_at:397:339; Interrogation_Position=3069; Antisense; GCTCATCAACCCTGCATTATTTTTA
>probe:Drosophila_2:1632807_at:520:307; Interrogation_Position=3100; Antisense; CCATTGTGCCAATAGAGAAGTCAGC
>probe:Drosophila_2:1632807_at:276:423; Interrogation_Position=3114; Antisense; GAGAAGTCAGCACCACACAAAGAAA

Paste this into a BLAST search page for me
GTGACTAGCGAAATCGATCCATCCTTCGATCCATCCTTGAGTGTTAGTGTGAGTGTTAGTGTATCCGAGTGCATAGTATCCGAGTGCATAGAGAATCTTAGATATTTTATGTCCAGTTCGCTATGGCCGGTTAGTGTTAGATCCCATCGAATCACATATATTTTTAGCCGAGGAATTAAGTCAATTTTCACACGCATAAATACACTAGAGTGTTGAACGCATTTTGTTAAGTTTGTTTCAGTTTCTGTATGTTGTTTATGCTCATCAACCCTGCAGCTCATCAACCCTGCATTATTTTTACCATTGTGCCAATAGAGAAGTCAGCGAGAAGTCAGCACCACACAAAGAAA

Full Affymetrix probeset data:

Annotations for 1632807_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime