FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632808_at:

>probe:Drosophila_2:1632808_at:84:177; Interrogation_Position=377; Antisense; AAACTGCCAATATACCCATTTCCAT
>probe:Drosophila_2:1632808_at:524:179; Interrogation_Position=408; Antisense; AAACAACGTTGGAATCGCCACGCCG
>probe:Drosophila_2:1632808_at:12:311; Interrogation_Position=425; Antisense; CCACGCCGAAATCCTTGCTGAAATA
>probe:Drosophila_2:1632808_at:327:713; Interrogation_Position=517; Antisense; TTCTTCCAGCGCATGAAGGCGTCTA
>probe:Drosophila_2:1632808_at:263:597; Interrogation_Position=558; Antisense; TGTGAATGTTGGTTCCGGCACGGAA
>probe:Drosophila_2:1632808_at:569:293; Interrogation_Position=660; Antisense; CGAGGCGAAGCCTTATGGCATCCAT
>probe:Drosophila_2:1632808_at:252:49; Interrogation_Position=679; Antisense; ATCCATGTGCAGATGTTGTCCCCGA
>probe:Drosophila_2:1632808_at:503:183; Interrogation_Position=718; Antisense; AAAATCAACTCGTACTCCAGGCAGA
>probe:Drosophila_2:1632808_at:188:21; Interrogation_Position=745; Antisense; ATGAAGGGTGGTCTCCTAATCCCAT
>probe:Drosophila_2:1632808_at:536:41; Interrogation_Position=768; Antisense; ATCGGCGTCGGCTTATGCCAAGAGT
>probe:Drosophila_2:1632808_at:435:621; Interrogation_Position=792; Antisense; TGCGGTTAATCAGCTGCGGGACGAA
>probe:Drosophila_2:1632808_at:424:219; Interrogation_Position=815; Antisense; AAGTGGACGAGACTCCTGGTTACCT
>probe:Drosophila_2:1632808_at:191:521; Interrogation_Position=840; Antisense; GTGGCACCATGTCCAAAACGCTGTG
>probe:Drosophila_2:1632808_at:561:431; Interrogation_Position=884; Antisense; GAGTGCGAACCTATGTCGCCTGTAA

Paste this into a BLAST search page for me
AAACTGCCAATATACCCATTTCCATAAACAACGTTGGAATCGCCACGCCGCCACGCCGAAATCCTTGCTGAAATATTCTTCCAGCGCATGAAGGCGTCTATGTGAATGTTGGTTCCGGCACGGAACGAGGCGAAGCCTTATGGCATCCATATCCATGTGCAGATGTTGTCCCCGAAAAATCAACTCGTACTCCAGGCAGAATGAAGGGTGGTCTCCTAATCCCATATCGGCGTCGGCTTATGCCAAGAGTTGCGGTTAATCAGCTGCGGGACGAAAAGTGGACGAGACTCCTGGTTACCTGTGGCACCATGTCCAAAACGCTGTGGAGTGCGAACCTATGTCGCCTGTAA

Full Affymetrix probeset data:

Annotations for 1632808_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720