Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632809_at:

>probe:Drosophila_2:1632809_at:621:511; Interrogation_Position=3110; Antisense; GTGACATATCAAGAGCTCCCAGTAG
>probe:Drosophila_2:1632809_at:503:335; Interrogation_Position=3124; Antisense; GCTCCCAGTAGTAAGACACTCGGAT
>probe:Drosophila_2:1632809_at:528:145; Interrogation_Position=3141; Antisense; ACTCGGATGGCTCGACACAGCTAAT
>probe:Drosophila_2:1632809_at:525:667; Interrogation_Position=3187; Antisense; TACTTACATTTTTGAGGCATCTGAC
>probe:Drosophila_2:1632809_at:367:487; Interrogation_Position=3317; Antisense; GTACCTTTTCGATTATGTCTACGCA
>probe:Drosophila_2:1632809_at:259:675; Interrogation_Position=3361; Antisense; TAGCTATACTGACACTGACACTCCA
>probe:Drosophila_2:1632809_at:308:309; Interrogation_Position=3420; Antisense; CCACGCGGTGGCTTAGGTCAGTAGC
>probe:Drosophila_2:1632809_at:455:335; Interrogation_Position=3479; Antisense; GCTCGGGTCCGGAAATATTTTCAAG
>probe:Drosophila_2:1632809_at:302:17; Interrogation_Position=3495; Antisense; ATTTTCAAGAGAATGCGCCGCACCA
>probe:Drosophila_2:1632809_at:682:715; Interrogation_Position=3524; Antisense; TTCGGGTCAGTTTCCTTTGGCTAGA
>probe:Drosophila_2:1632809_at:396:583; Interrogation_Position=3541; Antisense; TGGCTAGAGCTGTTCTTTTCAAAAT
>probe:Drosophila_2:1632809_at:606:689; Interrogation_Position=3565; Antisense; TATTGCAAAACACTGAACCCCATCG
>probe:Drosophila_2:1632809_at:17:367; Interrogation_Position=3579; Antisense; GAACCCCATCGAAAGCTGGGCTTAC
>probe:Drosophila_2:1632809_at:710:523; Interrogation_Position=3596; Antisense; GGGCTTACATAATGCTCTCCATGTG

Paste this into a BLAST search page for me
GTGACATATCAAGAGCTCCCAGTAGGCTCCCAGTAGTAAGACACTCGGATACTCGGATGGCTCGACACAGCTAATTACTTACATTTTTGAGGCATCTGACGTACCTTTTCGATTATGTCTACGCATAGCTATACTGACACTGACACTCCACCACGCGGTGGCTTAGGTCAGTAGCGCTCGGGTCCGGAAATATTTTCAAGATTTTCAAGAGAATGCGCCGCACCATTCGGGTCAGTTTCCTTTGGCTAGATGGCTAGAGCTGTTCTTTTCAAAATTATTGCAAAACACTGAACCCCATCGGAACCCCATCGAAAGCTGGGCTTACGGGCTTACATAATGCTCTCCATGTG

Full Affymetrix probeset data:

Annotations for 1632809_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime