Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632810_at:

>probe:Drosophila_2:1632810_at:42:263; Interrogation_Position=1465; Antisense; CAGCTGCTGAAGGTTTACGCCGAAT
>probe:Drosophila_2:1632810_at:149:233; Interrogation_Position=1487; Antisense; AATCCGTAGCCAGCATTCCTAAGAA
>probe:Drosophila_2:1632810_at:149:47; Interrogation_Position=1511; Antisense; ATCCCCGCCGCGTAGAGCAAGTTGA
>probe:Drosophila_2:1632810_at:366:361; Interrogation_Position=1527; Antisense; GCAAGTTGATGTGGCCCTATTGGCA
>probe:Drosophila_2:1632810_at:318:307; Interrogation_Position=1542; Antisense; CCTATTGGCAGGGACCGCAGTGAAT
>probe:Drosophila_2:1632810_at:554:297; Interrogation_Position=1557; Antisense; CGCAGTGAATCCCACAGACGAGATT
>probe:Drosophila_2:1632810_at:589:539; Interrogation_Position=1600; Antisense; GGTATGTACTTGTGTCCCAGCTGCA
>probe:Drosophila_2:1632810_at:606:309; Interrogation_Position=1658; Antisense; GCCACTACAAGAGCGTCCACGAAAA
>probe:Drosophila_2:1632810_at:707:223; Interrogation_Position=1687; Antisense; AAGGACTTTGAGTGCCGTTTCTGCT
>probe:Drosophila_2:1632810_at:607:627; Interrogation_Position=1722; Antisense; TGCCAACTCGCAATCCGTGAAGCAA
>probe:Drosophila_2:1632810_at:284:175; Interrogation_Position=1770; Antisense; AAAGCCCTTCGAGTGTAAGACGTGT
>probe:Drosophila_2:1632810_at:189:659; Interrogation_Position=1785; Antisense; TAAGACGTGTGGCAATCGCTTTCGC
>probe:Drosophila_2:1632810_at:408:219; Interrogation_Position=1838; Antisense; AAGTCCATGACGAAAAGCCGGCGAA
>probe:Drosophila_2:1632810_at:91:171; Interrogation_Position=1893; Antisense; AAAGGTTGAGGCACTACGGCAGGAA

Paste this into a BLAST search page for me
CAGCTGCTGAAGGTTTACGCCGAATAATCCGTAGCCAGCATTCCTAAGAAATCCCCGCCGCGTAGAGCAAGTTGAGCAAGTTGATGTGGCCCTATTGGCACCTATTGGCAGGGACCGCAGTGAATCGCAGTGAATCCCACAGACGAGATTGGTATGTACTTGTGTCCCAGCTGCAGCCACTACAAGAGCGTCCACGAAAAAAGGACTTTGAGTGCCGTTTCTGCTTGCCAACTCGCAATCCGTGAAGCAAAAAGCCCTTCGAGTGTAAGACGTGTTAAGACGTGTGGCAATCGCTTTCGCAAGTCCATGACGAAAAGCCGGCGAAAAAGGTTGAGGCACTACGGCAGGAA

Full Affymetrix probeset data:

Annotations for 1632810_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime