FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632811_at:

>probe:Drosophila_2:1632811_at:699:549; Interrogation_Position=172; Antisense; GGAGTCTACTTTGGATGCGGCACAC
>probe:Drosophila_2:1632811_at:564:91; Interrogation_Position=212; Antisense; AGTATCGATCACTTTGGGTGCGCCG
>probe:Drosophila_2:1632811_at:419:47; Interrogation_Position=256; Antisense; ATCCTGATGCTGCTGTCCGAAATAA
>probe:Drosophila_2:1632811_at:718:119; Interrogation_Position=293; Antisense; AGCTGGTGCACTGGATCGACTGCCA
>probe:Drosophila_2:1632811_at:342:235; Interrogation_Position=326; Antisense; AATCCTTTCTGAGCCTCTTCGAGGA
>probe:Drosophila_2:1632811_at:70:363; Interrogation_Position=416; Antisense; GCAATCTGTTCCTGCGTGGCGATGT
>probe:Drosophila_2:1632811_at:691:441; Interrogation_Position=436; Antisense; GATGTCTTCGATGTGTTCCGCTTGC
>probe:Drosophila_2:1632811_at:591:321; Interrogation_Position=487; Antisense; GCCCTAAACTCGACAGCTGGTGAAT
>probe:Drosophila_2:1632811_at:164:613; Interrogation_Position=507; Antisense; TGAATGGCGGGTGTCCTTGGACTTC
>probe:Drosophila_2:1632811_at:328:283; Interrogation_Position=532; Antisense; CTGCTAATCGGCTATTTCCCAAAAA
>probe:Drosophila_2:1632811_at:713:181; Interrogation_Position=553; Antisense; AAAACTTCACTCTGGAGGCAGTCGC
>probe:Drosophila_2:1632811_at:149:73; Interrogation_Position=568; Antisense; AGGCAGTCGCTCTATGTGGAATATA
>probe:Drosophila_2:1632811_at:701:417; Interrogation_Position=649; Antisense; GAGCTCCTCATCTACAAGCGTATGT
>probe:Drosophila_2:1632811_at:545:681; Interrogation_Position=669; Antisense; TATGTGTCGCCTGTGTCTGCAGCAA

Paste this into a BLAST search page for me
GGAGTCTACTTTGGATGCGGCACACAGTATCGATCACTTTGGGTGCGCCGATCCTGATGCTGCTGTCCGAAATAAAGCTGGTGCACTGGATCGACTGCCAAATCCTTTCTGAGCCTCTTCGAGGAGCAATCTGTTCCTGCGTGGCGATGTGATGTCTTCGATGTGTTCCGCTTGCGCCCTAAACTCGACAGCTGGTGAATTGAATGGCGGGTGTCCTTGGACTTCCTGCTAATCGGCTATTTCCCAAAAAAAAACTTCACTCTGGAGGCAGTCGCAGGCAGTCGCTCTATGTGGAATATAGAGCTCCTCATCTACAAGCGTATGTTATGTGTCGCCTGTGTCTGCAGCAA

Full Affymetrix probeset data:

Annotations for 1632811_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720