FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632812_at:

>probe:Drosophila_2:1632812_at:455:523; Interrogation_Position=1395; Antisense; GGGCTTTCGGCCAGAGTTGATTCAG
>probe:Drosophila_2:1632812_at:449:713; Interrogation_Position=1415; Antisense; TTCAGGCTCAGCAGGATATCTTGCA
>probe:Drosophila_2:1632812_at:254:165; Interrogation_Position=1457; Antisense; AAATAATGGGCTCACTGTTGCGTCC
>probe:Drosophila_2:1632812_at:181:79; Interrogation_Position=1565; Antisense; AGGATCAGCAGACGCTACTTCGCTA
>probe:Drosophila_2:1632812_at:370:413; Interrogation_Position=1622; Antisense; GACCTTTTCGTCGATGTGGTCTACG
>probe:Drosophila_2:1632812_at:409:519; Interrogation_Position=1637; Antisense; GTGGTCTACGACTTTGGAAGCCGCC
>probe:Drosophila_2:1632812_at:212:457; Interrogation_Position=1675; Antisense; GATACATTAGCTGCCGATTCCGATG
>probe:Drosophila_2:1632812_at:438:401; Interrogation_Position=1699; Antisense; GACTACTGGTTGTGTTACATCCGAT
>probe:Drosophila_2:1632812_at:32:293; Interrogation_Position=1720; Antisense; CGATATTTCTATGTGGGTGCCTGGC
>probe:Drosophila_2:1632812_at:31:357; Interrogation_Position=1754; Antisense; GCACTTGTCGCATGGCTCCAAGAAA
>probe:Drosophila_2:1632812_at:57:645; Interrogation_Position=1845; Antisense; TCTTCGTGTGGTGGATGCCAGCATT
>probe:Drosophila_2:1632812_at:210:705; Interrogation_Position=1868; Antisense; TTATGCCGGAATTGCCAGCGGGCAA
>probe:Drosophila_2:1632812_at:359:67; Interrogation_Position=1898; Antisense; ATGGACCCGCCATGATGATTGGTGA
>probe:Drosophila_2:1632812_at:439:461; Interrogation_Position=1938; Antisense; GATTCTCGACGATCGGGAGGCGAAT

Paste this into a BLAST search page for me
GGGCTTTCGGCCAGAGTTGATTCAGTTCAGGCTCAGCAGGATATCTTGCAAAATAATGGGCTCACTGTTGCGTCCAGGATCAGCAGACGCTACTTCGCTAGACCTTTTCGTCGATGTGGTCTACGGTGGTCTACGACTTTGGAAGCCGCCGATACATTAGCTGCCGATTCCGATGGACTACTGGTTGTGTTACATCCGATCGATATTTCTATGTGGGTGCCTGGCGCACTTGTCGCATGGCTCCAAGAAATCTTCGTGTGGTGGATGCCAGCATTTTATGCCGGAATTGCCAGCGGGCAAATGGACCCGCCATGATGATTGGTGAGATTCTCGACGATCGGGAGGCGAAT

Full Affymetrix probeset data:

Annotations for 1632812_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720