FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632813_at:

>probe:Drosophila_2:1632813_at:229:529; Interrogation_Position=1006; Antisense; GGGACCTCGATGTGTATGTGCCTTT
>probe:Drosophila_2:1632813_at:399:449; Interrogation_Position=1037; Antisense; GATCCTAATTCGGTTGTGGCCATTT
>probe:Drosophila_2:1632813_at:524:307; Interrogation_Position=1056; Antisense; CCATTTGTGCAGACGGCCACTATTA
>probe:Drosophila_2:1632813_at:723:103; Interrogation_Position=1117; Antisense; AGACATCTGCACACAATTCCTTGAG
>probe:Drosophila_2:1632813_at:620:725; Interrogation_Position=1137; Antisense; TTGAGCTGCAAGACGATGAGACCTA
>probe:Drosophila_2:1632813_at:468:165; Interrogation_Position=1167; Antisense; AAATCCGATTGTTGCGAACGCCTTT
>probe:Drosophila_2:1632813_at:150:325; Interrogation_Position=1180; Antisense; GCGAACGCCTTTGATGCATCTATAC
>probe:Drosophila_2:1632813_at:492:133; Interrogation_Position=828; Antisense; ACGCCAACATATTCTGCATCAACTT
>probe:Drosophila_2:1632813_at:262:191; Interrogation_Position=848; Antisense; AACTTTAACCACCAGTCCACAATGG
>probe:Drosophila_2:1632813_at:173:31; Interrogation_Position=899; Antisense; ATACACGTCTTCAACCTGGAGGACA
>probe:Drosophila_2:1632813_at:256:589; Interrogation_Position=915; Antisense; TGGAGGACAACAAGCCCCGTGAATC
>probe:Drosophila_2:1632813_at:646:27; Interrogation_Position=953; Antisense; ATACCCAAGTATTTCTCGAGCCAGT
>probe:Drosophila_2:1632813_at:35:637; Interrogation_Position=968; Antisense; TCGAGCCAGTGGAGTTTTGTCAAGT
>probe:Drosophila_2:1632813_at:673:599; Interrogation_Position=985; Antisense; TGTCAAGTTTTCAATACCCCAGGGA

Paste this into a BLAST search page for me
GGGACCTCGATGTGTATGTGCCTTTGATCCTAATTCGGTTGTGGCCATTTCCATTTGTGCAGACGGCCACTATTAAGACATCTGCACACAATTCCTTGAGTTGAGCTGCAAGACGATGAGACCTAAAATCCGATTGTTGCGAACGCCTTTGCGAACGCCTTTGATGCATCTATACACGCCAACATATTCTGCATCAACTTAACTTTAACCACCAGTCCACAATGGATACACGTCTTCAACCTGGAGGACATGGAGGACAACAAGCCCCGTGAATCATACCCAAGTATTTCTCGAGCCAGTTCGAGCCAGTGGAGTTTTGTCAAGTTGTCAAGTTTTCAATACCCCAGGGA

Full Affymetrix probeset data:

Annotations for 1632813_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720