FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632814_at:

>probe:Drosophila_2:1632814_at:342:361; Interrogation_Position=153; Antisense; GCAAGCAGCACAACCTCGAGGATGT
>probe:Drosophila_2:1632814_at:154:563; Interrogation_Position=189; Antisense; GGAATACCGCCCTATTGAAGGCCTG
>probe:Drosophila_2:1632814_at:252:371; Interrogation_Position=205; Antisense; GAAGGCCTGCTATTTGGGTCGATTT
>probe:Drosophila_2:1632814_at:650:535; Interrogation_Position=221; Antisense; GGTCGATTTGAGTGCGCTCGTACGC
>probe:Drosophila_2:1632814_at:353:291; Interrogation_Position=239; Antisense; CGTACGCTGCTGGAATTCGGTGCAA
>probe:Drosophila_2:1632814_at:175:693; Interrogation_Position=284; Antisense; TTTGGTCAAAATGCCCTGACACTGG
>probe:Drosophila_2:1632814_at:467:399; Interrogation_Position=301; Antisense; GACACTGGCCACTTATGCTGGGCAT
>probe:Drosophila_2:1632814_at:426:301; Interrogation_Position=396; Antisense; CCCTCTGTGTGGCTACACTGCAAAA
>probe:Drosophila_2:1632814_at:518:181; Interrogation_Position=418; Antisense; AAAACACTCCGCTTTGGTGGCCTAT
>probe:Drosophila_2:1632814_at:271:533; Interrogation_Position=433; Antisense; GGTGGCCTATTTTACTCAATTGGAT
>probe:Drosophila_2:1632814_at:622:637; Interrogation_Position=560; Antisense; TCTCCTCCCACTTTTATTAGCAATC
>probe:Drosophila_2:1632814_at:588:237; Interrogation_Position=581; Antisense; AATCGTCTGCGTTAATGTATTGTCA
>probe:Drosophila_2:1632814_at:536:167; Interrogation_Position=82; Antisense; AAATGCACTCAGCTGCGTTGGACAG
>probe:Drosophila_2:1632814_at:336:727; Interrogation_Position=99; Antisense; TTGGACAGGACGATGTCGTTTCCCT

Paste this into a BLAST search page for me
GCAAGCAGCACAACCTCGAGGATGTGGAATACCGCCCTATTGAAGGCCTGGAAGGCCTGCTATTTGGGTCGATTTGGTCGATTTGAGTGCGCTCGTACGCCGTACGCTGCTGGAATTCGGTGCAATTTGGTCAAAATGCCCTGACACTGGGACACTGGCCACTTATGCTGGGCATCCCTCTGTGTGGCTACACTGCAAAAAAAACACTCCGCTTTGGTGGCCTATGGTGGCCTATTTTACTCAATTGGATTCTCCTCCCACTTTTATTAGCAATCAATCGTCTGCGTTAATGTATTGTCAAAATGCACTCAGCTGCGTTGGACAGTTGGACAGGACGATGTCGTTTCCCT

Full Affymetrix probeset data:

Annotations for 1632814_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720