Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632815_at:

>probe:Drosophila_2:1632815_at:413:433; Interrogation_Position=3291; Antisense; GAGGGCGACTTTCGATTCCCGCATG
>probe:Drosophila_2:1632815_at:104:581; Interrogation_Position=3371; Antisense; GGCCAATAGCCATCTGTCCGAAATG
>probe:Drosophila_2:1632815_at:395:523; Interrogation_Position=3428; Antisense; GGGCCAGCTCCACTTGACAAATAAT
>probe:Drosophila_2:1632815_at:711:289; Interrogation_Position=3479; Antisense; CGGGCGCGCAGTGAGCAGCAATAAC
>probe:Drosophila_2:1632815_at:459:199; Interrogation_Position=3501; Antisense; AACGACATGTCCGAGAGCTTGCAGC
>probe:Drosophila_2:1632815_at:319:353; Interrogation_Position=3521; Antisense; GCAGCTAGATTTAGGCGATGGCCCG
>probe:Drosophila_2:1632815_at:94:441; Interrogation_Position=3537; Antisense; GATGGCCCGAGTCCTCATATAATTG
>probe:Drosophila_2:1632815_at:132:87; Interrogation_Position=3564; Antisense; AGTGCTGTCGGTTCAATGACTCTAC
>probe:Drosophila_2:1632815_at:687:683; Interrogation_Position=3621; Antisense; TATCACCACTTTATGCAGCGTTCGA
>probe:Drosophila_2:1632815_at:728:351; Interrogation_Position=3635; Antisense; GCAGCGTTCGAATTCGCCATTTGAA
>probe:Drosophila_2:1632815_at:593:633; Interrogation_Position=3648; Antisense; TCGCCATTTGAAATCCTGCGGCAAG
>probe:Drosophila_2:1632815_at:689:527; Interrogation_Position=3708; Antisense; GGGACATACAATTCTGGACCACCAA
>probe:Drosophila_2:1632815_at:349:101; Interrogation_Position=3742; Antisense; AGAGATTTCGAGTGGCACCCGATCA
>probe:Drosophila_2:1632815_at:393:303; Interrogation_Position=3760; Antisense; CCGATCACGGGCATTATTTTAGCAT

Paste this into a BLAST search page for me
GAGGGCGACTTTCGATTCCCGCATGGGCCAATAGCCATCTGTCCGAAATGGGGCCAGCTCCACTTGACAAATAATCGGGCGCGCAGTGAGCAGCAATAACAACGACATGTCCGAGAGCTTGCAGCGCAGCTAGATTTAGGCGATGGCCCGGATGGCCCGAGTCCTCATATAATTGAGTGCTGTCGGTTCAATGACTCTACTATCACCACTTTATGCAGCGTTCGAGCAGCGTTCGAATTCGCCATTTGAATCGCCATTTGAAATCCTGCGGCAAGGGGACATACAATTCTGGACCACCAAAGAGATTTCGAGTGGCACCCGATCACCGATCACGGGCATTATTTTAGCAT

Full Affymetrix probeset data:

Annotations for 1632815_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime